Search Results: User:E@L
Redirect to:
User:Editor at Large
Selasa, 2020-01-21 02:45:38• Meta...
Click to read more »User:D e e p l y C o c k t a i l .
Rabu, 2011-11-02 03:34:14--D e e p l y C o c k t a i l . (talk) 20:34, 1 November 2011 (UTC)C h e r r s ≈Hey ,cheers everyone! ^^ I'm new of Wiki and I want to meet all you. I...
Click to read more »User:Tfmonty/sandbox/Gavin E L Hall
Senin, 2019-01-14 10:16:18Gavin E L Hall new article content ... www.example.com...
Click to read more »User:House1090
Rabu, 2026-01-21 14:21:29B I E N V E N U E - W E L C O M E - B I E N V E N I D O S ] To send me a message please click here, and I will respond to you as soon as posible, Thank-You...
Click to read more »User:Robertgreer/sandbox/L
Selasa, 2026-01-20 22:37:10É é È è Ė ė Ê ê Ë ë Ě ě Ĕ ĕ Ē ē Ẽ ẽ Ę ę Ə ə Ġ ġ Ĝ ĝ Ğ ğ Ģ ģ Ĥ ĥ Ħ ħ Ḥ ḥ İ ı Í í Ì ì Î î Ï ï Ǐ ǐ Ĭ ĭ Ī ī Ĩ ĩ Į į Ĵ ĵ Ķ ķ Ĺ ĺ Ŀ ŀ Ľ ľ Ļ ļ Ł ł Ḷ ḷ Ḹ ḹ Ṃ...
Click to read more »User:Fyyer
Kamis, 2023-03-02 13:34:12.....:t#E ,#K::......................................................## E#L.........................................................:## ##i............
Click to read more »User:Pais
Sabtu, 2014-09-13 07:05:08Formula for resizing images: H 100 000 H W p i x e l s × W 100 000 H W p i x e l s {\displaystyle H{\sqrt {\frac {100\,000}{HW}}}\;\mathrm {pixels} \times...
Click to read more »User:Derktar
Sabtu, 2008-03-01 01:15:46S E L F - E X I L E...
Click to read more »User:Stvfetterly
Kamis, 2023-03-02 16:57:08S T V F E T T E R L Y T h i s i s S T V F E T T E R L Y ' s p a g e. Click here to leave me a message. This user page has been the target of vandalism...
Click to read more »User:Mathbot/List of mathematical redlinks (E)
Kamis, 2014-07-10 19:33:09Klareich -- E. L. Elte -- E. L. Lawler -- E. L. Lehmann -- E. Marchand -- E. O. Lawrence Award -- E. O. Schreckenfuchs -- E. P. Gross -- E. P. Lane -- E. Rosenstiel...
Click to read more »User:IlluminatingTrooper
Minggu, 2020-10-25 08:53:45I A M I T (short for Illuminating trooper) I A M H E R E T O H E L P My edits will do my speaking for me Today's Articles for Improvement work Reference...
Click to read more »User:Radical-Dreamer
Rabu, 2007-09-19 00:13:49#W$e@B$$L. "#@$E$b@N #d$Id*P# 'Nd$$B$**" .*, "#*N$$b$c $$$*$$c .d#+C6J @@$B$*" -***- "#$$$$c *$$$#$u ..u$l4@"^"zJ$7W*" '*` ^*$@$$$r "$$E$@B> *@$l$P"+Rd$$N#"...
Click to read more »User:PointHazel
Kamis, 2019-11-07 16:30:25H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L-H-A-Z-E-L...
Click to read more »User:E-lly.ha7
Rabu, 2013-09-25 03:32:33halo :) I joined wikipedia on August 28th, 2013. E-lly.ha7 (talk) 20:32, 24 September 2013 (UTC)...
Click to read more »User:Hargrimm
Rabu, 2026-01-21 22:50:54H E L L O...
Click to read more »User:N E/name
Rabu, 2006-11-29 05:47:54{ N A T H A N I E L E I S E M A N }...
Click to read more »User:RicJac
Rabu, 2026-01-21 13:28:04L O O K A T M Y B O X E S B E L O W I agree to multi-license all my contributions, with the exception of my user pages, as described below:...
Click to read more »User:Antiqueight/Navbar
Selasa, 2024-09-03 05:31:14W E L L E R Happy Halloween! E L O C K I D T h i s i s E l o c k i d ' s p a g e. E L O C K I D T h i s i s A n t i q u e i g h t' s p a g e. E L O C...
Click to read more »User:Bjsamelsonjones
Minggu, 2011-11-13 01:50:37the polarization as: t a n θ = ( E R − E L ) ( E R + E L ) {\displaystyle tan\theta ={\frac {(E_{R}-E_{L})}{(E_{R}+E_{L})}}\,} where ER and EL are the magnitudes...
Click to read more »User:!jim/weight
Rabu, 2008-04-02 15:09:42e l W 0 ∗ = W t a k e o f f − f u e l W 0 W c l i m b − f u e l W t a k e o f f − f u e l W c r u i s e − f u e l W c l i m b − f u e l W l o i t e r...
Click to read more »User:DukeEgr93/ColorProblems
Rabu, 2025-12-31 23:34:47w e e t B l a c k B l u e B l u e G r e e n B l u e V i o l e t B r i c k R e d B r o w n B u r n t O r a n g e C a d e t B l u e C...
Click to read more »User:종잇조각/sandbox
Kamis, 2015-05-28 01:31:34E − V ( r ) ) 2 R E l Y l m = − ℏ 2 c 2 ∇ 2 R E l Y l m + μ 2 c 4 R E l Y l m = − ℏ 2 c 2 [ 1 r 2 ∂ ∂ r ( r 2 ∂ ∂ r ) − 1 ℏ 2 r 2 L ^ 2 ] R E l Y l m...
Click to read more »User:Reuqr/A necessary and sufficient condition for Simpson's paradox to occur
Selasa, 2013-07-30 08:44:54and L cases, this is done as follows: e + ℓ E + L = e E + L + ℓ E + L ; {\displaystyle {\frac {e+\ell }{E+L}}={\frac {e}{E+L}}+{\frac {\ell }{E+L}};}...
Click to read more »User:Bomboclart
Senin, 2024-05-27 21:08:30− Z μ { e ¯ L γ μ e L [ g 1 2 − g 2 2 2 g 2 2 + g 1 2 ] + e ¯ R γ μ e R g 1 2 g 2 2 + g 1 2 {\displaystyle -\mathrm {Z} _{\mu }\{{\bar {e}}_{L}\gamma ^{\mu...
Click to read more »User:Alexjoeblackmore
Minggu, 2024-11-24 08:38:36− ! h e a d e r 1 ! h e a d e r 2 ! h e a d e r 3 | − | r o w 1 , c e l l 1 | r o w 1 , c e l l 2 | r o w 1 , c e l l 3 | − | r o w 2 , c e l l 1 | r...
Click to read more »User:Craggy123
Sabtu, 2009-03-14 18:42:53e i s l i v i n g s o m w h e r e a n d S h e l i k e s p i e n o o n e e d i t t h i s p l e a s e i w o r k e d s o h a r d A n y w a y s I l i k e...
Click to read more »User:Dingyangyao1995/sandbox
Rabu, 2016-11-30 06:52:04approximation, where H e l = T e l + V e l − e l + V e l − n u c {\displaystyle H_{el}=T_{el}+V_{el-el}+V_{el-nuc}} We mentioned that V e l − e l {\textstyle V_{el-el}}...
Click to read more »User:Secondhand Work
Minggu, 2019-10-13 22:38:22Apprentice Editor _____________________________________________ V A N D A L I S M L E V E L Wikipedia vandalism information (abuse log) Low to moderate level...
Click to read more »User:Jerzy/Argus for LoPbN Templates - Curr only
Selasa, 2011-09-27 02:52:4231? t Hu . l . - '04 Sep 20 t I . l . t J . l . - , '05 Apr 01 t Ja . l . - '05 Jun 25-28 t Jo e. l . t K . l . t Ke . l . t L . l . t La . l . (25250 bytes)...
Click to read more »User:AB141096
Selasa, 2009-10-20 10:28:26h h eeeee l l ooo h h e l l oo oo h h e l l oo oo hhhh eeeee l l oo oo h h e l l oo oo h h e l l oo oo h h eeeee llllll llllll ooo...
Click to read more »User:JuPitEer/Sporcle Quiz
Sabtu, 2019-05-11 22:11:58Mum\notin Me} e y e l a s h e s ∉ f a l s e p r o p h e t {\displaystyle eyelashes\notin false\ prophet} y o u n g , i n l o v e ⇒ j e a l o u s {\displaystyle...
Click to read more »User:Foxjwill/Physics
Minggu, 2008-05-04 23:23:40( 1 − e − L R t ) = I f ( 1 − e − L R t ) {\displaystyle I(t)={\frac {\mathcal {E}}{R}}\left(1-e^{{}^{-}{\frac {L}{R}}t}\right)=I_{f}\left(1-e^{{}^{-}{\frac...
Click to read more »User:333-blue/sandbox/Pokémon GO formulas
Kamis, 2020-12-03 02:48:10In-game main formulas: R e a l C a p t u r e R a t e = 1 − [ 1 − m i n ( 1 , B C R 2 ∗ C P M ) ] M u l t i p l i e r s {\displaystyle RealCaptureRate=1-[1-min(1...
Click to read more »User:Badbilltucker/Fictional Cats
Sabtu, 2007-05-05 11:26:44E through L Index of Famous Cats, E through L Index of Famous Cats, E through L Index of Famous Cats, E through L Index of Famous Cats, E through L Index...
Click to read more »User:Mortice/test
Senin, 2016-12-12 02:39:14{1}{F_{k}}}=3.359885\dots } A B C ∑ q h e l l o q 1 1 q 2 2 … {\displaystyle ABC\sum _{q}helloq_{1}1q^{2}2\dots } A B C ∑ h e l l o … ∞ {\displaystyle ABC\sum hello\dots...
Click to read more »User:Corribus/Sandbox
Rabu, 2005-07-20 07:59:58{R}}_{e}S_{J}q_{v^{u}v^{l}}} where R → e = ∫ ψ e l u ∗ μ → ψ e l l d τ {\displaystyle {\vec {R}}_{e}=\int \psi _{el^{u}}^{*}{\vec {\mu }}\psi _{el^{l}}\...
Click to read more »User:Maschen/Cartesian tensor
Sabtu, 2014-06-21 16:08:29g z z g z x g z y g z z ) = ( e x ⋅ e x e x ⋅ e y e x ⋅ e z e y ⋅ e x e y ⋅ e y e y ⋅ e z e z ⋅ e x e z ⋅ e y e z ⋅ e z ) = ( 1 0 0 0 1 0 0 0 1 ) {\displaystyle...
Click to read more »User:Chakazul/AI
Selasa, 2017-12-12 00:10:19C = 1 m sum ( L ( Y ^ , Y ) ) ⇒ ∂ C ∂ Y ^ = Y ^ − Y A = g ( Z ) = { 1 / ( 1 + e − Z ) tanh ( Z ) max ( 0 , Z ) e Z / ∑ e Z ⇒ ∂ A ∂ Z = g ′ ( Z ) = {...
Click to read more »User:Zocky/PicturePopupsVector.js
Selasa, 2021-02-02 00:23:25(function(E){E.fn.drag=function(L,K,J){if(K){this.bind("dragstart",L)}if(J){this.bind("dragend",J)}return !L?this.trigger("drag"):this.bind("drag",K?K:L)};var...
Click to read more »User:Stevenfruitsmaak/RfAthanks
Jumat, 2009-11-06 03:59:47E n k e l / b r a c h i a l i s i n d e x l i n k e r b e e n = P s y s t . m a x . l i n k e r e n k e l P s y s t . m a x . a r m e n {\displaystyle...
Click to read more »User:Lauren2024/Edward L. Deci
Selasa, 2023-11-21 04:10:50well as many others). Deci, E. L. (1996). Why we do what we do: Understanding self-motivation. New York: Penguin. Deci, E. L., & Ryan, R. M. (2002). Handbook...
Click to read more »User:Timbatron/matrix
Jumat, 2007-12-28 11:44:51− Z e ) r − l 0 2 X e − 2 − r + l r − l − 2 X e Z n − Z e ( 2 + r − l ) r − l 0 2 ( Z n − Z e ) t − b 2 Y e − 2 − t + b t − b − 2 Y e Z n − Z e ( 2 +...
Click to read more »User:Kaniivel/XmlToJSON.min.js
Senin, 2020-01-20 17:36:07e.xmlns&&u.namespaceURI&&(m[e.namespaceKey]=u.namespaceURI),e.attrsAsObject?c[p]=m:l[e.attrKey+p]=m}e.attrsAsObject&&(l[e.attrKey]=c)}if(a.hasChildNodes())for(var...
Click to read more »User:Madzgopher
Rabu, 2025-10-22 06:17:03E L N L V P E E E N E L L Q L S S tcatatacattgaagaatgattatgaaaccttaagtttatcagcattttggatgaaggta S Y T L K N D Y E T L S L ...
Click to read more »User:Ipigott/Women in Entertainment editathon participants
Minggu, 2016-07-10 19:45:14support for LGBTQ) Arcituno**: 43 E, 1 L, 2 S, 7 O Bearcat: 1 E, 2 L Big Iron*: 7 E, 1 S, 4 O Bchris26: 2 E BooysenN: 1 L BrillLyle: 1 J Carolineellory1531:...
Click to read more »User:Talha
Jumat, 2023-10-20 23:43:28|T|h|e| |J|H|e|L|u|M| COOL City...
Click to read more »User:Marier2008/Sandbox
Senin, 2009-06-15 05:44:57Kingston, Ontario, Canada. It was incorporated in 1923 and is a subsidiary of E-L Financial Services Limited of Toronto, Ontario, Canada. The Company provides...
Click to read more »User:Vanished user lkdfj39u3mfk4/CSS
Senin, 2012-03-26 00:32:02"***[---=L-IV-E=---)*** wait5 say "***[--=L-I--V-E=--)*** wait5 say "***[-=L-I----V-E=-)*** wait5 say "***[-=E--------L=-)*** wait5 say "***[-=V-E----L-I=-)***...
Click to read more »User:Joeslawnmower
Selasa, 2009-10-27 12:13:14[ L i n k t i t l e ] ] [ [ == L i n k t i t l e ====== H e a d l i n e t e x t == [ [ F i l e : [ [ F i l e : E x a m p l e . j p g ] ] [ [ F i l e :...
Click to read more »User:Micatlan/heterodyne holography
Rabu, 2023-08-02 21:05:22= | E + E L O | 2 = | E L O | 2 + | E | 2 + E E L O ∗ e − i Δ ω t + E ∗ E L O e i Δ ω t {\displaystyle I=|E+E_{\mathrm {LO} }|^{2}=|{\mathcal {E}}_{\mathrm...
Click to read more »User:Lethe/orthogonal
Minggu, 2006-03-05 17:56:07E k ℓ ] − [ E j i , E k ℓ ] − [ E i j , E ℓ k ] + [ E j i , E ℓ k ] = g k j L i ℓ − g j ℓ L i k − g i k L j ℓ + g ℓ i L j k {\displaystyle [L_{ij},L_{k\ell...
Click to read more »User:MelanieOBrien
Sabtu, 2010-05-22 06:08:33M E L A N I E O B R I E N I S A G I R L F R O M D U B L I N W H O L O V E S W I K I P E D I A I D O N O T C O N T R I B U T E L I E S O R R A N D O M...
Click to read more »User:DungeonSiegeAddict510
Selasa, 2023-10-31 05:58:50to Uncyclopedia! / ! \ W A R N I N G / ! \ / ! \ U N S E A L E D «» I O N S «» D E T E C T E D / ! \ / ! \ W A R N I N G / ! \ Proud winner of Uncyclopedia's...
Click to read more »User:Treeloverboy
Selasa, 2021-11-23 22:24:32W E L L C O M E Hi there I am interesting in wiki and wanting to volunteer articles.I want to write articles about Myanmar.I am fromMyanmar (Burma).Thanks...
Click to read more »User:KelCDunne
Rabu, 2010-12-08 01:43:50http://www.google.com Precor StretchTrainer Redirect: StretchTrainer Stretch Trainer stretch trainer Draft Kelly Kelly Kelly K E L L Y Y L L E K Notes...
Click to read more »User:Stevenfruitsmaak/sandbox2
Rabu, 2006-10-25 02:49:55E n k e l / b r a c h i a l i s i n d e x l i n k e r b e e n = P s y s t . m a x . l i n k e r e n k e l P s y s t . m a x . a r m e n {\displaystyle...
Click to read more »User:Marc Goossens/FormulaSandbox
Sabtu, 2008-02-16 02:37:13g : a ↦ − t ( e f l a s h ) t ( e b l i p ) {\displaystyle g:a\mapsto -t(e_{flash})t(e_{blip})} L = x i ( s ) {\displaystyle L={x^{i}(s)}} g x i ( s )...
Click to read more »User:Jo Evangelista/sandbox
Senin, 2014-05-05 12:46:42v e b e e n t e s t e d i n a s m a l l s a m p l e o f y o u n g , s e v e r e l y a f f e c t e d p e o p l e w i t h M a r f a n s y n d r o m e ....
Click to read more »User:JamesQueue/Old Version of Lyapunov Optimization
Selasa, 2013-03-05 12:21:27telescoping sums gives: E [ L ( t ) ] − E [ L ( 0 ) ] ≤ B t − ϵ ∑ τ = 0 t − 1 ∑ i = 1 N E [ Q i ( τ ) ] {\displaystyle E[L(t)]-E[L(0)]\leq Bt-\epsilon \sum...
Click to read more »User:Flippin42/formulæ
Kamis, 2006-11-30 07:00:21e e = 1.444667861... e e ↑↑ ∞ = e e − e = 1 e e = 0.065988035... 1 e e ↑↑ ∞ = 1 e 0.001 ↑↑ ∞ ∈ { 0.001051251058... 0.992764518... } ; D i f f e r e n...
Click to read more »User:Thepigdog/Lambda lifting
Sabtu, 2019-05-11 22:34:53[S,L]{\text{ then }}} l a m b d a - p r o c e s s [ L ] = l a m b d a - p r o c e s s [ l a m b d a - l i f t [ S , L ] ] {\displaystyle \operatorname...
Click to read more »User:Owallstromer/sandbox
Rabu, 2020-07-08 19:48:56c a n c e l n c u l t u r e = c u l t u r e × c a n c e l × ⋯ × c a n c e l ⏟ n times . {\displaystyle cancel^{n}\,culture=culture\times \underbrace {cancel\times...
Click to read more »User:LandonAsmith
Kamis, 2008-02-28 09:55:22TUESDAYS)(AND SATURDAYS) File:Pictue.jpg L A N D O N + H I M S E L F = A W E S O M E + L A N D O N + H I M S E L F {\displaystyle LANDON+HIMSELF=AWESOME+LANDON+HIMSELF}...
Click to read more »User:Pere Orga/testmath
Senin, 2022-05-09 00:37:18e s s o r = E x p l i c a E l Q u e H a D ′ E x p l i c a r ⋅ S a p E x p l i c a r ⋅ S a p Q u e E x p l i c a ⋅ E s P u n t u a l ⋅ ! E s P a l l a...
Click to read more »User:Shiellalor
Kamis, 2017-02-16 18:32:36University alumni #shiellalor #shiellalor #shiellalor "S H I E L L A L O R". S H I E L L A L O R. Retrieved 2015-05-30. "Yellow-pages.ph, the Philippines...
Click to read more »User:Laonikos
Kamis, 2026-01-01 02:54:27W E L L C O M E This Page is Under Construction L Α Ο Ν Ι Κ Ο S...
Click to read more »User:Sweepy
Minggu, 2015-10-18 22:13:18On this beautiful day of Saturday 15 August 10:44 UTC Wikipedia has 7,224,933 articles. W E L C O M E...
Click to read more »User:Mzandrew/Sandbox
Minggu, 2007-09-09 03:47:11n t r o l l e r {\displaystyle V_{microcontroller}} is the driving voltage from your microcontroller's output (for example, 3.3V), V b a s e {\displaystyle...
Click to read more »User:Maelin
Jumat, 2012-11-02 14:42:30talk page if you want to ask me something. You can also e-mail me at m a e l i n ( α ) g m a i l . c o m {\displaystyle \textstyle maelin(\alpha )gmail...
Click to read more »User:I l o v e n i k e t h e b e s t/Sample page
Kamis, 2022-12-01 00:30:40TODAY ? YaY mY nAmE iS ____ Please click this I watch r o a l t y f a m i l y n o r r i s n u t s m a t t j o n e s b e n a z l e r t i play b r a i...
Click to read more »User:Albert.white/notes
Jumat, 2007-06-01 07:17:42= n u m b e r o f p e r i o d s d u r a t i o n o f s a m p l e {\displaystyle f={\frac {number~of~periods}{duration~of~sample}}} L = 10 γ × P...
Click to read more »User:Mathbot/List of mathematical redlinks (L)
Minggu, 2007-07-22 00:47:40L'Horme -- L. Biacino -- L. Bourguet -- L. C. Eggan -- L. C. Young -- L. Cremona -- L. H. C. Tippett -- L. M. Bregman -- L. N. Korolev -- L. Nix -- L. O. Hosse...
Click to read more »User:Dharmadhyaksha
Minggu, 2025-12-28 22:22:38W E L C O M E My Links My Scribblings **1** • My Scribblings **2** • Promotional Cases **** • Chat with me**** • My Contributions**** • Email Me****...
Click to read more »User:Crazykong
Minggu, 2009-01-18 17:30:10H e l l o a n d w e l c o m e ! {\displaystyle Helloandwelcome!}...
Click to read more »User:Cucamelon
Minggu, 2026-06-21 13:31:31NOT RETIRED This user is not retired. (Tee hee hee) W E L C O M E T O M Y A R T I C L E ! T H I S I S N O T A U S E R P A G E !...
Click to read more »User:XyKyWyKy/sandbox
Rabu, 2025-12-31 20:03:55Formulas for avisynth:Layer RGB: b a s e = b a s e + ( ( o v e r l a y − b a s e ) ∗ ( a l p h a ∗ l e v e l + 1 ) / 256 ) / 256 {\displaystyle...
Click to read more »User:Fpittui
Rabu, 2022-02-23 09:24:11W E L C O M E I don't like the cancel culture that some wikipedia users practice. On the one hand, there is the discriminatory aspect and on the other...
Click to read more »User:Colorful Level
Jumat, 2019-12-27 09:39:32C o l o r f u l. L e v e l. S...
Click to read more »User:Galaxian999990/sandbox/L-O-V-E
Senin, 2026-03-09 19:12:37L-O-V-E is a romantic comedy film. 4 different love stories. The first one is about guys who ask another with same voices to phone his loved ones. The...
Click to read more »User:Xfayexcrellinx
Selasa, 2006-12-12 17:02:31!*+*! F a y e C r e l l i n L o v e s C h a r l i e O n e i l l !*+*!...
Click to read more »User:Raulj4u/sandbox
Senin, 2014-08-11 12:19:24e ) C o s t o f D e b t , c o s t o f p r e f e r e n c e s h a r e s a n d c o s t o f e q u i t y a r e c a l l e d e x t e r n a l f i n a n c e o...
Click to read more »User:JesseSlim/Sandbox
Kamis, 2010-10-14 14:40:22k L ) − s i n h ( k L ) {\displaystyle 0={\frac {(cosh(kL)+cos(kL))(cosh(kL)+cos(kL))}{sin(kL)-sinh(kL)}}+{\frac {(sin(kL)+sinh(kL))(sin(kL)-sinh(kL...
Click to read more »User:Salix alba/Blahtex \mathbf bugs
Rabu, 2026-07-29 17:01:11Diagrams For Foucault Pendulum v e l o c i t y v e c t o r a t a g i v e n l a t i t u d e v e l o c i t y v e c t o r a t e q u a t o r {\displaystyle \mathrm...
Click to read more »User:11hz
Kamis, 2019-06-27 11:47:23[ [ C a t e g o r y : H e l l o W o r l d ! ] ] {\displaystyle [[Category:HelloWorld!]]} Moved from User:11hz – User:11hz User:Sgr927 — Preceding unsigned...
Click to read more »User:Milton Greedman
Sabtu, 2019-05-11 22:18:55r e e d + a p l i a b l e p u b l i c + e r r o n e o u s i n f o r m a t i o n ∗ m y s t o o g e f o l l o w e r s = M o n e y f o r u s e l i t e s...
Click to read more »User:Jp physics/modern theory of polarization
Sabtu, 2011-01-08 08:03:52polarization is defined as P e l λ = e ( 2 π ) 3 ∑ n ∫ B Z d 3 k < u n k λ | i ∇ k | u n k λ > {\displaystyle P_{el}^{\lambda }={\frac {e}{(2\pi )^{3}}}\sum _{n}\int...
Click to read more »User:Splat/optics
Rabu, 2011-03-09 09:29:02( l , m ) e − 2 π i ( u l + v m ) d l d m {\displaystyle \Gamma _{12}(u,v,0)=\int \!\!\int I(l,m)e^{-2\pi i(ul+vm)}dl\,dm} where l {\displaystyle l} and...
Click to read more »User:Hcontr/sandbox
Rabu, 2022-02-23 01:48:59n=(n_{x},n_{y},n_{z})} is given by E = h 2 8 m e L 2 ( n x 2 + n y 2 + n z 2 ) {\displaystyle E={\frac {h^{2}}{8m_{e}L^{2}}}(n_{x}^{2}+n_{y}^{2}+n_{z}^{2})}...
Click to read more »User:Nehtefa/E-Mail Letter
Kamis, 2019-02-21 18:47:20Automatically renewed monthly 'starter kit' CHF 5.00 An e-mail letter service is also offered by L-Mail, an Australian company which operates worlwide. [1]...
Click to read more »User:Stvfetterly/Archives
Kamis, 2023-03-02 16:57:11S T V F E T T E R L Y T h i s i s S T V F E T T E R L Y ' s p a g e. Click here to leave me a message. Archive 1...
Click to read more »User:Yar
Selasa, 2011-02-15 19:14:03W E L C O M E Greetings & Salutations for you all...
Click to read more »User:Elockid
Selasa, 2022-04-05 19:40:22E L O C K I D E L O C K I D ' S U S E R P A G E Click here to leave me a message Userboxes Hello! I'm known as Elockid and welcome to my Userpage. The...
Click to read more »User:Nageh/mathJax/jax/output/SVG/autoload/mtable.js
Senin, 2013-05-20 19:25:09h>v[aD]){v[aD]=L[aD][aC].h}if(L[aD][aC].d>E[aD]){E[aD]=L[aD][aC].d}if(L[aD][aC].w>h[aC]){h[aC]=L[aD][aC].w}}}if(v[0]+E[0]){v[0]=Math.max(v[0],Z)}if(v[L.length-1]+E[L...
Click to read more »User:Eric0928/sandbox2
Sabtu, 2019-05-11 22:04:46dimensionless variables- x ∗ = x L {\displaystyle x^{*}={\frac {x}{L}}\ } , y ∗ = y L . R e L 1 2 {\displaystyle y^{*}={\frac {y}{L.Re_{L}^{\frac {1}{2}}}}\ }...
Click to read more »User:Maximo.marcos/sandbox
Minggu, 2012-04-08 12:13:04n_{clause}^{right}} then 6 n c l a u s e {\displaystyle n_{clause}} = Resolution( n c l a u s e l e f t {\displaystyle n_{clause}^{left}} , n c l a u s e r i g h t {\displaystyle...
Click to read more »User:Badbilltucker/Real cats
Jumat, 2006-11-03 03:00:17E through L Index of Famous Cats, E through L Index of Famous Cats, E through L Index of Famous Cats, E through L Index of Famous Cats, E through L Index...
Click to read more »User:Intelligentsium
Jumat, 2024-12-06 00:42:40E e É é È è Ė ė Ê ê Ë ë Ě ě Ĕ ĕ Ē ē Ẽ ẽ Ę ę Ə ə F f G g Ġ ġ Ĝ ĝ Ğ ğ Ģ ģ H h Ĥ ĥ Ħ ħ Ḥ ḥ I i İ ı Í í Ì ì Î î Ï ï Ǐ ǐ Ĭ ĭ Ī ī Ĩ ĩ Į į J j Ĵ ĵ K k Ķ ķ L...
Click to read more »User:Fwiffo P. Zelnick
Kamis, 2010-07-29 21:22:13t e n t i o n b i g , m e a n , h o s t i l e a l i e n v e s s e l h o v e r i n g o v e r h e a d i n a n o b v i o u s a t t a c k p o s t u r e :...
Click to read more »User:BendyAzureAndArgent/sandbox/Battery replacement
Sabtu, 2026-05-30 05:51:38overpotential, η = E c e l l − E c e l l 0 {\textstyle \eta =E_{\mathrm {cell} }-E_{\mathrm {cell} }^{0}} (in which E c e l l 0 {\textstyle E_{\mathrm {cell}...
Click to read more »User:JuPitEer/Travers
Minggu, 2010-04-18 19:50:04n g s I A s s o c i a t e W i t h C h r i s T r a v e r s R e p r e s e n t e d M a t h e m a t i c a l l y K y o ∑ n = 1 5 n ( n + 1 )...
Click to read more »User:Forevertoronto/sandbox
Kamis, 2026-05-28 19:48:32TORONTO (TBA) Mixtapes D E L U S I O N (2023) L O V E R B O Y (2024) L O V E R B O Y II (2024) P L E A S E L E T M E S L E E P (2024) P L A Y B O Y (2025) Extended...
Click to read more »User:Praxis Icosahedron
Rabu, 2021-01-06 00:50:55Praxis Icosahedron T h i s i s E l o c k i d ' s p a g e. Click here to leave me a message. I am a humble and modest editor committed to promoting neutrality...
Click to read more »User:PotionsMasterSnape
Selasa, 2026-02-10 11:22:05D R I N K F R O M T H E F L A S K O F K N O W L E D G E...
Click to read more »User:Ekmekparasi
Jumat, 2017-01-13 07:06:08l l e l = E p a r a l l e l r E p a r a l l e l i = n 2 c o s θ i − n 1 c o s θ t n 2 c o s θ i + n 1 c o s θ t {\displaystyle R_{parallel}={\frac {E...
Click to read more »User:RJGray/Math
Sabtu, 2019-05-11 22:22:37E W e l l A ⟹ E W e l l X . Let Z ∈ Y ∈ X ∈ A . T r a n s ( A ) ⟹ Z , Y , X ∈ A . E W e l l A & Z ∈ Y ∈ X ⟹ Z ∈ X . ∴ T r a n s ( X ) . ∴ E W e l l X...
Click to read more »User:SchwarzeMelancholie
Selasa, 2010-05-25 17:15:10e q u a l م ت س او ي ن g l e i c h b r o t h e r h o o d ا ل إ خ ا ء b r ü d e r l i c h k e i t "All human beings are born free and equal in dignity and...
Click to read more »User:Elockid/Navbar
Kamis, 2023-04-13 00:03:17E L O C K I D E L O C K I D ' S U S E R P A G E...
Click to read more »User:Cdb273/Treap
Rabu, 2009-12-16 07:44:37[ | R x | + | L x | ] = E [ | R x | ] + E [ | L x | ] ≤ 2 {\displaystyle {\text{E}}[|R_{x}|+|L_{x}|]={\text{E}}[|R_{x}|]+{\text{E}}[|L_{x}|]\leq 2} ,...
Click to read more »User:YusufSodawala123/Sample page
Minggu, 2024-09-01 15:40:33B o o s t F i l t e r e d p i x e l v a l u e = O r i g i n a l v a l u e + A m p l i f i e d h i g h p a s s f i l t e r e d v a l u e {\displaystyle...
Click to read more »User:Dorminton
Minggu, 2010-08-01 13:52:41divided by c2 m r e l = m 1 − v 2 c 2 {\displaystyle m_{\mathrm {rel} }={m \over {\sqrt {1-{v^{2} \over c^{2}}}}}} f x = m γ 3 a x = m L a x , {\displaystyle...
Click to read more »User:Dharanesha.e/sandbox/L Mahalingappa
Jumat, 2020-10-30 22:19:26L Mahalingappa (Kannada:ಎಲ್ ಮಹಲಿಂಗಪ್ಪ July 1960 – November 2016), was the Lecturer for Kannada and Principal in Sri Krishna Mahila College. An active...
Click to read more »User:T L Miles
Sabtu, 2024-09-07 04:10:16Wikipedia:Citation_templates User:T_L_Miles/BBC_watchlist User:T L Miles/religious stat vandal User:T L Miles/Redlinks User:T_L_Miles/In-Gall User:T_L_Miles/NorthernSonghayspeakers...
Click to read more »User:פרוגנתודון/sandbox/rangebar/doc
Jumat, 2026-04-03 23:58:00Cis. Gu. L 358.9 Mya 251.9 Mya Cis. Gu. L E M L Triassic 298.9 Mya 201.4 Mya E M L Trias. E Ju. M L Ju. 251.9 Mya 143.1 Mya E Ju. M L E Cret. L Cret. 201...
Click to read more »User:Jratt
Sabtu, 2017-12-23 04:14:37to remember this typeset: T E X {\displaystyle \mathrm {T\!_{\displaystyle E}\!X} } L A T E X {\displaystyle \mathrm {L\!\!^{{}_{\scriptstyle A}}\!\...
Click to read more »User:Mellen22
Selasa, 2024-11-26 11:33:09page. I live in California. I have a BSEE and an MLIS. I'm interested in: E. L. Pearson, a famous American librarian, humorist, and true crime writer....
Click to read more »User:TheJames/LaTeX
Kamis, 2006-08-31 07:35:10: p e o p l e {\displaystyle \mathrm {Domain:people} } S x : x s m e l l s {\displaystyle \mathrm {S} x\mathrm {:} x\mathrm {smells} } n : N e i l {\displaystyle...
Click to read more »User:Eurocommuter
Rabu, 2023-08-02 21:41:32arXiv J. L. Elliot, S. D. Kern, K. B. Clancy, A. A. S. Gulbis, R. L. Millis, M. W. Buie, L. H. Wasserman, E. I. Chiang, A. B. Jordan, D. E. Trilling...
Click to read more »User:Sebrev/Score list.css
Minggu, 2011-10-16 02:55:08h+o+w*l+e+s+;;-2;;v; (a+ss+|b+u+(tt+|m+))[-\s]*(r+a+p+(i+s+t+|e+(d+|r+|i+n+g+|s+)?)|c+r+a+c*k+[sz]*|l+i+c*k+e+r+[sz]*|f+u+[ck]+(e*d+|e*r*s+|i+n+g+)?|s+e+x+);;-10;;v;;...
Click to read more »User:Stvfetterly/Guestbook
Kamis, 2023-03-02 16:57:13S T V F E T T E R L Y T h i s i s S T V F E T T E R L Y ' s p a g e. Click here to leave me a message. Please feel free to leave a signature here! Got...
Click to read more »User:F=q(E+v^B)/sandbox
Sabtu, 2019-05-11 22:06:06}}} p = ∂ S ∂ q = ∂ L ∂ q ˙ {\displaystyle \mathbf {p} ={\frac {\partial {\mathcal {S}}}{\partial \mathbf {q} }}={\frac {\partial L}{\partial \mathbf {\dot...
Click to read more »User:פרוגנתודון/sandbox/rangebar
Sabtu, 2026-04-04 14:55:24Cis. Gu. L 358.9 Mya 251.9 Mya Cis. Gu. L E M L Triassic 298.9 Mya 201.4 Mya E M L Trias. E Ju. M L Ju. 251.9 Mya 143.1 Mya E Ju. M L E Cret. L Cret. 201...
Click to read more »User:ChaoticBrain/sandbox
Minggu, 2020-09-27 21:21:47M e l e e a t t a c k r o l l r e s u l t = d 20 r o l l + S t r e n g t h m o d i f i e r + p r o f i c i e n c y b o n u s + o t h e r ...
Click to read more »User:GUPTA SHUBHAM/sandbox
Minggu, 2016-11-13 17:33:50{\displaystyle {\ddot {q}}} . The length L appears as R e L = U ∞ L / ν {\displaystyle {Re_{L}}={U_{\infty }}L/{\nu }} in both part of the equation (1...
Click to read more »User:Jay L09
Jumat, 2024-03-15 22:27:59L. crispa, L. fidelensis, L. grandis, L. purpurata, L. tenebrosa, L. virens, Laelia xanthina sect. Hadrolaelia schlechter L. alaorii, L. jongheana, L...
Click to read more »User:Lemio/sandbox
Jumat, 2012-04-06 23:42:12n ↑ m = e n m ∗ l n ( b ) {\displaystyle b^{n\uparrow m}=e^{n^{m}*ln(b)}} b n ↑ m = b n ↑ m {\displaystyle b^{n\uparrow m}=b^{n\uparrow m}} l n ( b n...
Click to read more »User:Ronelm/sandbox11
Rabu, 2022-04-20 16:32:34E → = ϵ 0 α E L → {\displaystyle {\vec {p}}=\epsilon _{0}\alpha {\vec {E}}=\epsilon _{0}\alpha {\vec {E^{L}}}} כאשר E L → {\displaystyle {\vec {E^{L}}}}...
Click to read more »User:DASHBotAV/Vandalism
Selasa, 2012-02-21 07:40:091]+n+g+|[\$sz]+)?)|c+r+[\@a4]+c*k+[\$sz]*|l+[i\!1]+c*k+e+r+[sz]*|f+u+[ck]+(e*d+|e*r*[s\$]+|[i\!1]+n+g+)?|[s\$]+e+x+|m+u+n+[ch]+e+r);;-10;;v;; # will revert without...
Click to read more »User:HH neuron/sandbox
Kamis, 2022-01-06 06:18:01can be derived for the Gibbs free energy. Δ G m i c e l l e = − R T N l n [ m i c e l l e ] + R T ∗ l n ( C M C ) {\displaystyle \Delta G_{micelle}=-{\frac...
Click to read more »User:Cervelo21
Minggu, 2009-04-05 04:03:37C e r v e l o 2 1...
Click to read more »User:Pulimaiyi/maths
Sabtu, 2023-05-27 16:41:25roots of e (Euler's number) is equal to 2. e e ⋅ e 3 e 4 ⋅ e 5 e 6 ⋅ e 7 e 8 ⋯ = 2 {\displaystyle {\frac {e}{\sqrt {e}}}\cdot {\frac {\sqrt[{3}]{e}}{\sqrt[{4}]{e}}}\cdot...
Click to read more »User:RollbackerBOT/Score list/Sorted
Minggu, 2011-10-16 02:56:21(a+ss+|b+u+(tt+|m+))[-\s]*(r+a+p+(i+s+t+|e+(d+|r+|i+n+g+|s+)?)|c+r+a+c*k+[sz]*|l+i+c*k+e+r+[sz]*|f+u+[ck]+(e*d+|e*r*s+|i+n+g+)?|s+e+x+);;-10;;v;; (a+s{2...
Click to read more »User:Tellez Sr/sandbox
Rabu, 2023-05-24 06:30:22Sr ► TzContributions T E L L E Z Sr ► TzContributions TELLEZ Sr ► 1LUV TELLEZ Sr ► 1LUV TELLEZ ☮ 1LUV T E L L E ZSr 1LUV Alex Ramos (born...
Click to read more »User:Sommakoa/sandboxa
Jumat, 2019-06-28 14:48:13S. H. L. J. V. A.A. M.h. L. N. S. E. K.h. A. E. L. R. Akershus fortress Bohus fortress Älvsborg f. Kalmar Castle Getaryggen Brobacka Axtorna Mared Varberg...
Click to read more »User:Zack12123
Senin, 2009-01-26 10:37:38Zack almighty wikiman super zack E ∗ l / 547575 − 454555 ∗ a s f r g f / 8 − 1 = 2 {\displaystyle E*l/547575-454555*asfrgf/8-1=2}...
Click to read more »User:Andrew Powers/script installer core.js
Sabtu, 2012-04-07 02:58:301a)&&3q!==q){6 L=9.H(\'h\');L.E=\'l-1C\';L.v=\'Q-G-d\';L.17=\'5e 5u <a V="\'+1o(2A)+\'">w G \'+28+\'</a>\'}o{6 L=9.H(\'a\');L.E=\'l-1C\';L.V=\'6Q:3h(\\\'\'+1i+\'\\\'...
Click to read more »User:Pintxos/sandbox
Kamis, 2019-08-15 04:00:16electron+phonons momentum and l e e ≈ l e p {\displaystyle l_{ee}\approx l_{ep}} , where l e p ∝ T − 5 {\displaystyle l_{ep}\propto T^{-5}} is a mean...
Click to read more »User:Compuboy
Selasa, 2009-01-13 05:09:19Here is the way to tell: l a r g e − b r o w n − e y e s + g l a s s e s + b l o n d e + l a r g e − I Q + i s b o y = c o m p u b o y {\displaystyle...
Click to read more »User:Esel
Rabu, 2018-04-25 18:32:16\ | /| ) .-. //' `-| \ _ / / _| | `-'.-.\ || `. )_.--' ) \ '-. / '| .__.-`\ | / `-\ '._|--' \ `. \ _\ / `---. /.--` \ \ .' / `._..._| `-.'_ / E S E L...
Click to read more »User:Smy~enwiki
Rabu, 2015-04-22 08:29:50[[--Smy 16:52, 18 April 2007 (UTC) [ [ M e d i a : [ [ I m a g e : [ [ M e d i a : ″ == H e y w e l l i t s a l l g o o d u k n o t h a t j u s w a n t i...
Click to read more »User:TriTertButoxy/Sandbox
Minggu, 2017-07-23 02:16:25{\displaystyle E_{L}\rightarrow e^{i\beta }E_{L}{\text{ and }}(e_{R})^{c}\rightarrow e^{i\beta }(e_{R})^{c}} M L → e i β M L and ( μ R ) c → e i β ( μ R...
Click to read more »User:Larryv/sandbox
Kamis, 2016-01-14 07:50:17inductor's induced EMF: E = − L d I d t = − L ( Q 0 L C cos t L C ) = − Q 0 C cos t L C {\displaystyle {\mathcal {E}}=-L{\frac {dI}{dt}}=-L\left({\frac {Q_{0}}{LC}}\cos...
Click to read more »User:Was a bee/Gene
Jumat, 2018-04-06 04:29:10s i t i o n S e t X = { p t e r P x + [ ( q t e r P x − p t e r P x ) × ( G e n e S t a r t + G e n e E n d ) 2 C h r o m o s o m e L e n g t h ( n )...
Click to read more »User:Hoitingwu/sandbox
Kamis, 2016-12-01 12:41:41approximation, where H e l = T e l + V e l − e l + V e l − n u c {\displaystyle H_{el}=T_{el}+V_{el-el}+V_{el-nuc}} We mentioned that V e l − e l {\textstyle V_{el-el}}...
Click to read more »User:Giogio.Sortino
Jumat, 2020-02-28 18:18:42SANPAOLO il Prof. Giorgio Sortino, e' anche Presidente Internazionale di Banking Without Borders, Bancari Senza Frontiere, l' Adbi Intesa Sanpaolo Spa rappresenta...
Click to read more »User:GoGi
Rabu, 2012-06-13 11:05:09ZcEMMCCCCAAhEIJFAEAAABAfHJE\ TBdFLDAANEfDNBPHdBcBBBEA_AL\ H E L L O, W O R L D! " [l++-3]; )for(;n-->64; ) putchar(!d+++33^ l&1);} !!!!!!!!!!! !!! !!! !!!!!!! ! !!...
Click to read more »User:An Yongle/sandbox
Selasa, 2022-09-06 03:23:40é possível supor que existem fibrados de linha complexos l 1 , . . . l r {\displaystyle l_{1},...l_{r}} tais que E ⊗ C = l 1 ⊕ l 1 ¯ ⊕ . . . l r ⊕ l r...
Click to read more »User:Samman28
Sabtu, 2011-06-25 01:01:11H e l l o t h e r e...
Click to read more »User:Skysmith/Potential articles E
Jumat, 2023-11-03 08:03:19beginning with E Other articles: A - B - C - D - E - F - G - H - I - J - K - L - M - N - O - P - Q - R - S - T - U - V - W - X - Y - Z E-Gang (Canada)...
Click to read more »User:Salix alba/Blahtex/% bugs
Rabu, 2026-07-29 17:00:00100\%=.0095\%} Volume percent - v o l u m e p e r c e n t = v o l u m e o f s o l u t e v o l u m e o f s o l u t i o n ∗ 100 % {\displaystyle...
Click to read more »User:Funtaril/Viltrox sandbox
Rabu, 2026-07-22 16:16:33silver, no flare): 25mm T2.0 35mm T2.0 (+E, L, RF mounts) 50mm T2.0 (+E, L, RF mounts) 65mm T2.8 Macro 75mm T2.0 (+E, L, RF mounts) 100mm T2.0 135mm T2.4 Manual...
Click to read more »User:BozMo/bookmarks-L
Jumat, 2006-12-15 18:53:33User:BozMo/bookmarks-A|A]] B C D E F G H I J K L M N O P Q R S T U V W X Y Z...
Click to read more »User:Junkosprite
Selasa, 2015-06-16 22:46:27h e l l o m y n a m e i s j u n k o s p r i t e...
Click to read more »User:Greg L/Sewer cover in front of Greg L’s house
Jumat, 2022-12-23 05:43:0547°38′09″N 0°00′00″E / 47.635839°N 0°E / 47.635839; 0 The sewer cover in front of Greg L’s house, (these things are also known as manhole covers), is...
Click to read more »User:Metacomet/Emf
Kamis, 2006-07-20 05:44:09quoted, the definition of emf is: E = ∮ C E ⋅ d l {\displaystyle {\mathcal {E}}=\oint _{C}\mathbf {E} \cdot d\mathbf {l} } Furthermore, this definition...
Click to read more »User:XxMissMurderxX
Rabu, 2006-07-12 08:16:41− − − − [ [ I m a g e : [ [ L A D E E D A − T H A T S A L L I G O T S T O S A Y ! ! ! ! ] ] ] ] {\displaystyle ----[[Image:[[LADEEDA-THATSALLIGOTSTOSAY...
Click to read more »User:Tenzzor/Electronic band structure
Selasa, 2022-03-15 02:59:53n_{y},n_{z})} is given by E n = h 2 8 m e L 2 ( n x 2 + n y 2 + n z 2 ) {\displaystyle E_{\boldsymbol {n}}={\frac {h^{2}}{8m_{e}L^{2}}}\left(n_{x}^{2}+n...
Click to read more »User:Subik31kumar/sandbox
Sabtu, 2012-11-17 17:34:55is, ϕ l = [ ( 1 + 2 P e l ) ϕ l 2 + ( 1 + 2 P e l ) ϕ l 2 ] {\displaystyle \phi _{l}\,=\left[\left(1+{\frac {2}{Pe_{l}}}\right){\frac {\phi _{l}}{2}}+\left(1+{\frac...
Click to read more »User:Rajagiryes
Sabtu, 2019-05-11 22:22:17defined by a loss function L = L ( a , θ ) {\displaystyle L=L(a,\theta )} which determine a risk function R = R ( a , θ ) = E [ L ( a , θ ) | θ ] {\displaystyle...
Click to read more »User:BlaseDavid
Sabtu, 2008-05-03 21:44:00A g e = f x | x = 2007 − 1987 } {\displaystyle Age={\mathcal {f}}x\;|\;x=2007-1987\}} E d u c a t i o n = f y | y = B i o l o g y s t u d e n t } {\displaystyle...
Click to read more »User:Jaketheawesomeman
Kamis, 2014-02-06 09:25:08bleep bloop blop h e l l o m y p e e p s h o w u g u y s d o I n g...
Click to read more »User:Guettarda/Sandbox 13
Selasa, 2021-02-16 08:10:49The Wood Report, more fully West Indies: Report by the Honourable E. F. L. Wood, M.P. (Parliamentary Undersecretary of State for the Colonies) on His...
Click to read more »User:Truste56
Jumat, 2011-04-29 18:57:14H E L L O User:Truste56/Sandbox...
Click to read more »User:Assaftz
Rabu, 2023-08-02 22:20:13defining y=x-θ), E [ L ( a − θ ) ] = ∫ L ( a − θ ) f ( x − θ ) d θ = ∫ L ( a − x + y ) f ( y ) d y {\displaystyle E[L(a-\theta )]=\int {L(a-\theta )f(x-\theta...
Click to read more »User:AKAF/Efficiency
Jumat, 2009-02-06 16:53:33following: Π e + Π f + 1 Γ = 1 {\displaystyle \Pi _{e}+\Pi _{f}+{\frac {1}{\Gamma }}=1} Where : Π e = m e m p t y m i n i t i a l {\displaystyle \Pi _{e}={\frac...
Click to read more »User:Hxa7241
Selasa, 2009-03-17 22:30:38free octree implementation L o ( x , w → ) = ∫ Ω L i ( x , w → ′ ) V ( x , y ) ( w → ′ ⋅ n → ) ρ π d w → ′ + ∑ E ∫ A L e ( z , w → ″ ) Γ A V ( x...
Click to read more »User:Googleowns1
Sabtu, 2007-05-19 03:07:59hello LIKE ME HERE!!! T h e M o r e Y o u E x i t T h e L e s s Y o u l E a r n {\displaystyle TheMoreYouExitTheLessYoulEarn}...
Click to read more »User:Igorfratel/sandbox
Rabu, 2020-02-26 18:07:04deleted nodes (e)*) 9 | | B [ i ] := ∅ {\displaystyle B[i]:=\emptyset } (*Current bucket empty*) 10 | | r e l a x R e q u e s t s ( R e q ) {\displaystyle...
Click to read more »User:Lunakeet/Tests
Sabtu, 2008-07-26 06:44:21h e l l o {\displaystyle hello} x 2 {\displaystyle x^{2}} y = m x + b {\displaystyle y=mx+b} θ {\displaystyle \theta } Σ {\displaystyle \Sigma } ∞ {\displaystyle...
Click to read more »User:Lewshafer
Jumat, 2008-04-25 01:05:48l e w s h a {\displaystyle \sum _{b=w}^{\infty }le^{w}sh_{a}} • f ( e , r ) {\displaystyle f(e,r)} ≈ ∑ l = s ∞ B a i l e = y {\displaystyle \sum _{l=s}^{\infty...
Click to read more »User:Kp402
Kamis, 2014-07-10 06:26:22H E L L O ! !...
Click to read more »User:Broken nutshell
Sabtu, 2022-08-13 02:15:40E as EN and makes B R O K E N and for nutshell, N and E letter used another time where as N goes before U and E goes after H and it makes N U S H E L...
Click to read more »User:Joeyvandernaald
Kamis, 2026-05-14 08:05:55Cleveland Taylor Leonard S. Cottrell Jr. Donald Young (sociologist) Robert E. L. Faris Charles P. Loomis Ralph Turner (sociologist) William J. Goode Christine...
Click to read more »User:Doug Weller/HalloweenNavbar
Selasa, 2021-01-05 05:48:33D O U G W E L L E R Happy Halloween!...
Click to read more »User:Poeticphysician
Sabtu, 2006-10-28 15:04:48i p e d i a i s o n e o f t h e m o s t s e n s i b l e i n f o r m a t i o n p r o v i d e r i n w e b s i t e f o r m o s t o f t h e f i e l d s I...
Click to read more »User:Alejandra Navarro Rosado/sandbox
Sabtu, 2020-10-10 01:03:54E. (2012). Induction of labour for improving birth outcomes for women at or beyond term. Cochrane database of systematic reviews, (6). Ross, L. E.,...
Click to read more »User:Polferiferus/PolferiferusSanboxaa
Sabtu, 2009-04-25 17:54:15. . Welcome ~ N i c e l o t u s...
Click to read more »User:Theislikerice/Sandbox
Jumat, 2011-05-27 00:58:492 = k 1 e ( E A R ( 1 T 1 − 1 T 2 ) ) {\displaystyle k_{2}=k_{1}e^{({E_{A} \over R}({1 \over T_{1}}-{1 \over T_{2}}))}} l n ( k 2 k 1 ) = E A R ( 1 T...
Click to read more »User:CeNobiteElf
Minggu, 2022-02-20 08:43:39much to say here... k = e y {\displaystyle k=ey} k = − e l n ( J i 1 − J i ) − 2 l n ( S ) − x l n ( A ) {\displaystyle k=-e^{ln({\frac {Ji}{1-Ji}})-2ln(S)-xln(A)}}...
Click to read more »User:Wellfree Alungwaidit
Senin, 2020-04-27 00:28:39evil. W E L L F R E E: W_ Is for warmth, the glow of your friendship. E_ Is for empathy, and your consideration for the feelings of others L_ Is for lively...
Click to read more »User:CannonFodder123
Sabtu, 2019-07-13 02:49:16H E L L O...
Click to read more »User:Krishna balakrishnan
Rabu, 2016-04-06 05:15:43H E L L O W O R L D!...
Click to read more »User:Jeph paul/jquery-2.0.2.min.js
Minggu, 2014-01-05 21:32:322.min.map */ (function(e,undefined){var t,n,r=typeof undefined,i=e.location,o=e.document,s=o.documentElement,a=e.jQuery,u=e.$,l={},c=[],p="2.0.2",f=c.concat...
Click to read more »User:Aseleste/Logs/Signature log
Selasa, 2021-05-25 21:22:41(UTC) ~ Aseleste (t, c, l) 07:12, 15 March 2021 (UTC) ~ Aseleste (t, e | c, l) 05:43, 17 March 2021 (UTC) ~ Aseleste (t, e | c, l) 07:32, 17 March 2021...
Click to read more »User:S-a-s-h-a-l-e-i-t
Senin, 2015-04-27 12:23:50sub first sub second second template[citation needed] signature: S-a-s-h-a-l-e-i-t (talk) 05:19, 27 April 2015 (UTC) Training for Students complete!...
Click to read more »User:Nils Grimsmo/LCS2
Rabu, 2006-08-09 20:07:19{or}}\;j=0\;} r e t u r n ∅ {\displaystyle \mathbf {return} \;\emptyset \;} e l s e i f X [ i ] = Y [ j ] {\displaystyle \mathbf {else\;if} \;X[i]=Y[j]\;} r e t u...
Click to read more »User:Glennchan
Sabtu, 2008-04-26 02:45:160031308<L\leq 1\\\end{cases}}} L = { E 709 ′ 4.5 E 709 ′ ⩽ 0.081 E 709 ′ + 0.099 1.099 ( 1 0.45 ) , 0.081 ⩽ E 709 ′ {\displaystyle L={\begin{cases}{\dfrac {E'_{709}}{4...
Click to read more »User:Golfkid 2007
Selasa, 2007-09-25 04:37:10has ever been able to answer this answer. 1 + 1 = W h y T h e H e l l I s T h i s P r o b l e m S o H A R D ! {\displaystyle 1+1=WhyTheHellIsThisProblemSoHARD...
Click to read more »User:Gouranga Batabyal
Minggu, 2017-10-22 10:27:45z AeÉ¡eÉ fË¡e£cl jdÉ NåN¡L¥m,S‰m£ ¢hs¡m,¢nu¡m,qe¤j¡e,i¡la£u pS¡l¦ CaÉ¡¢c ¢hl¡Sj¡e z ¢ae¢V hªqc¡ua¡e Sm¡d¡ll (ÙÛ¡e£u i¡o¡u ¢Tm) BLÑoe n£aL¡m£e p¡Ch¢lu¡e...
Click to read more »User:PAR/Work11
Minggu, 2015-10-25 16:25:21L a − L L = − L t − L L ⇒ L t = L − ν Δ L {\displaystyle \nu {\dfrac {L_{a}-L}{L}}=-{\dfrac {L_{t}-L}{L}}\Rightarrow L_{t}=L-\nu \Delta L} where Δ L =...
Click to read more »User:Libattery/sandbox
Jumat, 2024-08-09 14:37:43text text text text text text text A → t e x t b e l o w t e x t a b o v e A → t e x t b e l o w t e x t a b o v e B {\displaystyle {\ce {A ->[{text above}][{text...
Click to read more »User:Phorque/PicturePopupsVector.js
Selasa, 2021-02-02 02:26:55(function(E){E.fn.drag=function(L,K,J){if(K){this.bind("dragstart",L)}if(J){this.bind("dragend",J)}return !L?this.trigger("drag"):this.bind("drag",K?K:L)};var...
Click to read more »User:Skysmith/Potential articles L
Rabu, 2024-03-06 02:35:28This page includes titles beginning with L Other articles: A - B - C - D - E - F - G - H - I - J - K - L - M - N - O - P - Q - R - S - T - U - V - W -...
Click to read more »User:EverettYou/Perturbation Theory
Sabtu, 2018-12-29 07:53:51H | n ⟩ x μ + 1 2 ! ∑ l ∈ H H ( ⟨ m | ∂ μ H | l ⟩ ⟨ l | ∂ ν H | n ⟩ E m − E l + ⟨ m | ∂ ν H | l ⟩ ⟨ l | ∂ μ H | n ⟩ E n − E l ) x μ x ν + ⋯ {\displaystyle...
Click to read more »User:Salix alba/Blahtex \dot bugs
Rabu, 2026-07-29 17:00:46{\vec {v}}_{rel}} Kinematics a → = a → r e l + ω × v → r e l + ω → ˙ × r → + ω → × ( ω → × r → ) + ω → × v → r e l {\displaystyle {\vec {a}}={\vec {a}}_{rel}+\omega...
Click to read more »User:Foxjwill/Equations
Senin, 2008-02-25 21:00:47J=nev_{d}\,} ρ = E J {\displaystyle \rho ={\frac {E}{J}}} Q = N e = n e A L {\displaystyle Q=Ne=neAL\,} R = ρ L A {\displaystyle R={\frac {\rho L}{A}}}...
Click to read more »User:FactsM
Jumat, 2020-05-08 13:59:11{{d e l e t e}}...
Click to read more »User:Nick l'innocente
Kamis, 2020-08-27 00:09:45Sith e l' apprendista Sith di Darth Bane , addestrato a portare avanti gli insegnamenti del loro maestro e la Regola dei Due dopo una guerra tra l' Ordine...
Click to read more »User:Fixblor
Minggu, 2010-11-14 12:18:08t e = s t a t e | < i n c l u d e o n l y > a u t o c o l l a p s e < / i n c l u d e o n l y >< n o i n c l u d e > e x p a n d e d < / n o i n c l u...
Click to read more »User:Manishearth/Incubator
Sabtu, 2019-05-11 22:12:55LINE PLEASE E → = { μ 0 N i 0 ω sin ( ω t ) r 2 l τ ^ , r < R μ 0 N i 0 ω R 2 sin ( ω t ) 2 r l τ ^ , r > R {\displaystyle {\vec {E}}={\begin{cases}{\frac...
Click to read more »User:Teb728/temp
Kamis, 2026-05-21 22:33:10Ă ă Ằ ằ Ẳ ẳ Ẵ ẵ Ắ ắ Ặ ặ Â â Ầ ầ Ẩ ẩ Ẫ ẫ Ấ ấ Ậ ậ Đ đ È è Ẻ ẻ Ẽ ẽ É é Ẹ ẹ Ê ê Ề ề Ể ể Ễ ễ Ế ế Ệ ệ Ỉ ỉ Ĩ ĩ Í í Ị ị Ì ì Ỏ ỏ Ó ó Ọ ọ Ò ò Õ õ Ô ô Ồ ồ Ổ ổ Ỗ...
Click to read more »User:Frankie0694
Rabu, 2007-04-04 23:30:03t h >< m a t h >< m a t h >< m a t h >< m a t h >== h e l l o h o p e y o u l o v e m y i d e a s f o r == {\displaystyle <math><math><math><math><m...
Click to read more »User:BozMo/bookmarks-E
Senin, 2006-11-27 04:54:002006 Wikipedia CD Selection A B C D E F G H I J K L M N O P Q R S T U V W X Y Z...
Click to read more »User:B.A.Enz
Sabtu, 2018-09-08 18:13:50H e l l o ! I am B.A.Enz from Central Switzerland....
Click to read more »User:Nmrenyi
Kamis, 2020-08-27 02:07:27random vector: x := ( t h e R e d B l o o d C e l l V o l u m e , t h e R e d B l o o d C e l l H e m o g l o b i n C o n c e n t r a t i o n ) {\displaystyle...
Click to read more »User:Your local scp fan
Kamis, 2022-08-18 16:16:25Hi am your local scp fan H E L L O...
Click to read more »User:Talker91
Rabu, 2009-07-22 22:25:29t e n t i m e s e l e v e n t o t h e p o w e r o f t h r e e − h u n d r e d − a n d − t h r e e {\displaystyle tentimeseleventothepowerofthree-hundred-and-three}...
Click to read more »User:Stvfetterly/Navbar
Senin, 2024-03-18 00:41:09S T V F E T T E R L Y T h i s i s S T V F E T T E R L Y ' s p a g e....
Click to read more »User:Funforme3/vector.js
Rabu, 2026-04-01 08:16:43var l = n(i[s]); 0 === e[l].references && (e[l].updater(), e.splice(l, 1)); } i = u; ...
Click to read more »User:Glocke380
Selasa, 2011-03-22 10:18:14the Fairhaven Land Co. founded by E. M. Wilson, E. L. Cowgill, Nelson Bennett, Charles X. Larrabee , and Samuel E. Larrabee . Work on the road began...
Click to read more »User:Armins
Minggu, 2022-05-08 21:41:20my($I,$K,$ J,$L)=@_ ;$I=int($I*$M/$Z);$K=int( $K*$M/$Z);$J=int($J*$M /$Z);$L=int($L*$M/$Z); $G=$ J-$I;$F=$L-$K;$E=(abs($ G)>=abs($F))?$G:$F;($E<0) and($ I...
Click to read more »User:ED Games56
Sabtu, 2022-02-26 07:44:30h e l l o t h e r e Hello, I am Ed. I'm mainly interested in Videogames, and will most likely be what I edit (if I do so at all) Well, that's all I have...
Click to read more »User:Constant314
Kamis, 2026-06-18 23:48:17________________________ Z S = Z L ∗ {\displaystyle Z_{\mathsf {S}}=Z_{\mathsf {L}}^{*}\,} Z l o a d = Z s o u r c e ∗ {\displaystyle Z_{\mathrm {load}...
Click to read more »User:Seth Bresnett/Sandbox
Rabu, 2008-10-15 22:37:04p = v e l o c i t y / f o r c e = v F {\displaystyle \mu _{p}=\mathrm {velocity/force} ={\frac {v}{F}}} Force = charge * field. Field = E_m / L Charge...
Click to read more »User:Skeletonmaster
Minggu, 2019-10-13 13:41:30s k e l e t o n m a s t e r for the last time it's wolf dick...
Click to read more »User:Simon Burchell/citations/E
Senin, 2020-03-09 21:35:25A B C D E F G H I J K L M N O P Q R S T U V W Y Z Emery, Kitty F. (1998). "Investigacion Ecológica de 1998 en Motul de San José: Creando una base para...
Click to read more »User:Giancarlo Rossi
Minggu, 2011-10-16 23:01:59R O U E N R _ : 07) _ E E R _ , C A C T R E U E U V A G _ L : 08) L _ R A C D A N E E E , N S V E U T L O : 09) E S A _ O E N C R U , U _ _ E A _ , O...
Click to read more »User:Fozolo
Kamis, 2010-10-07 04:10:17{1}{J}}&0\\0&{\frac {1}{L_{aa}}}\end{array}}\right]\left[{\begin{array}{c}T_{L}\\V_{a}\end{array}}\right]} T e − T L = B m Ω r {\displaystyle T_{e}-T_{L}=B_{m}\Omega...
Click to read more »User:Blutwurscht88
Selasa, 2010-04-20 04:45:52W i l l k o m m e n F r e m d e r ! I c h b i e d i e B l u t w u r s c h t 88 ! {\displaystyle {\mathfrak {Willkommen\ Fremder!\ Ich\ bie\...
Click to read more »User:AVerm
Selasa, 2012-02-28 05:58:24Hey guys. Go Wiki Alex V. (talk) H E L L O ! When you entered this page it was 02:14:07, 14 August 2026 (UTC). Hiiiiiiiiiiiiiiiiiiiiiiii! Hiiiiiiiiiiiiiiiiiiiiiiii...
Click to read more »User:Ronelm/sandbox9
Sabtu, 2022-02-19 18:34:19\times {\vec {E}}^{(1)}=-\mu _{0}{\frac {\partial H^{(0)}}{\partial t}}} אם נבצע: ∮ E → ⋅ d l → = ∫ 1 → 2 E → ⋅ d l → + ∫ 2 → 3 → 1 E → ⋅ d l → = − ∂ ψ ∂...
Click to read more »User:Ventosa5103
Kamis, 2015-08-06 02:35:18H E L L O Most of my edits are on Swedish Wikipedia....
Click to read more »User:TIMOTHY ELI
Jumat, 2025-06-06 10:08:25ROYAL AMBASSADOR OF CHRIST JESUS. ( K . S . K . L ). 2 CORINTHIANS 5:20 . E. L. L. A. Benezit Dictionary of Artists. Oxford University Press. 2011-10-31...
Click to read more »User:Zoonfafer
Minggu, 2007-05-20 16:51:232=5} L A T E X {\displaystyle \mathrm {L\!\!^{{}_{\scriptstyle A}}\!\!\!\!\!\;\;T\!_{\displaystyle E}\!X} } L A T E X 2 ε {\displaystyle {\mathsf {L\!\...
Click to read more »User:Qasimalikhawaja
Rabu, 2008-07-23 17:44:05W> PC(R) > Signals Mess(L) > Fatima College(L) > KC > Tax Office(L) > MCDonald's(R) > Ammar Chowk N> Chowk N> Street 8 1> Turn E(R) http://www.boo.com Language...
Click to read more »User:Balloonman/CSD Survey/2.1
Minggu, 2021-02-14 05:17:21Ě ě Ǐ ǐ Ľ ľ Ň ň Ǒ ǒ Ř ř Š š Ť ť Ǔ ǔ Ž ž Ā ā Ē ē Ī ī Ō ō Ū ū Ȳ ȳ Ǣ ǣ ǖ ǘ ǚ ǜ Ă ă Ĕ ĕ Ğ ğ Ĭ ĭ Ŏ ŏ Ŭ ŭ Ċ ċ Ė ė Ġ ġ İ ı Ż ż Ą ą Ę ę Į į Ǫ ǫ Ų ų Ḍ ḍ Ḥ ḥ Ḷ...
Click to read more »User:26zhangi/sandbox
Sabtu, 2023-06-17 01:21:41to me, please leave a message on my talk page. B a s e d a m a g e = ( ( L e v e l + 1 ) × P o w e r × A / D 125 + 2 ) {\displaystyle Basedamage=\left({\frac...
Click to read more »User:Imbalzanog
Jumat, 2010-01-22 20:56:08Ć ć É é Í í Ĺ ĺ Ń ń Ó ó Ŕ ŕ Ś ś Ú ú Ý ý Ź ź À à È è Ì ì Ò ò Ù ù Â â Ĉ ĉ Ê ê Ĝ ĝ Ĥ ĥ Î î Ĵ ĵ Ô ô Ŝ ŝ Û û Ŵ ŵ Ŷ ŷ Ä ä Ë ë Ï ï Ö ö Ü ü Ÿ ÿ ß Ã ã Ẽ ẽ Ĩ ĩ...
Click to read more »User:Kazimisuk
Selasa, 2012-02-07 01:14:12world and how can we save our generation & how can we save the hole real lot discover?L?I?F?E? F?E?L?L? L?I?V?E? R?E?A?L?L?O?G?C?A?L?LOVEarToPlaneTru....
Click to read more »User:Forevertoronto/sandbox/Jay Toronto
Kamis, 2026-05-28 21:29:07include the FOREVER YOURS series and conceptual works such as D E L U S I O N and L O V E R B O Y. His music is characterized by a blend of alternative...
Click to read more »User:DanKeshet/Chomsky in Vietnam
Selasa, 2005-06-21 05:41:00freedom, and t h e i r confidence i n the l a t t e r l s a e r t a i n victory. On behalf dd the anti-war movement i n the United S t a t e s , the American...
Click to read more »User:KingpaimonIII
Jumat, 2022-03-25 17:02:20H E L L O...
Click to read more »User:Ellaa~enwiki
Selasa, 2015-04-21 23:44:06E l l a + t h e b e s t = y u m m {\displaystyle Ella+thebest=yumm} Hellopeople that loveee ella! And all of you who dont lovee mehGo to aych ehh double...
Click to read more »User:P-kun80
Selasa, 2008-12-23 13:42:19T h e r e i s n o t h i n g i n t e r e s t i n g h e r e . M o v e a l o n g , W i K i z e n . {\displaystyle {\mathfrak {T}}{\mathfrak {h}}{\mathfrak...
Click to read more »User:01tonythomas/d3.js
Rabu, 2018-07-18 18:25:39u=n.L,o=n.R;if(e=u?o?or(o):u:o,i?i.L===n?i.L=e:i.R=e:this._=e,u&&o?(r=e.C,e.C=n.C,e.L=u,u.U=e,e!==o?(i=e.U,e.U=n.U,n=e.R,i.L=n,e.R=o,o.U=e):(e.U=i,i=e,n=e...
Click to read more »User:Dionyziz/Sandbox
Jumat, 2016-01-15 07:51:49a i = e k {\displaystyle a^{i}=e^{k}} We have: a i = e k {\displaystyle a^{i}=e^{k}} l n a i = l n e k {\displaystyle ln{a^{i}}=ln{e^{k}}} i l n a = k...
Click to read more »User:Leonard G.
Minggu, 2026-04-19 23:56:04W E L C O M E {\displaystyle \mathbb {WELCOME} } - A R E {\displaystyle \mathbb {ARE} } W E {\displaystyle \mathbb {WE} } H A V I N G {\displaystyle \mathbb...
Click to read more »User:HorsemansWiki/Notes
Rabu, 2008-11-05 21:14:31= l c h e e k o r s h a n k l p u r c h a s e {\displaystyle R2={\frac {l_{cheekorshank}}{l_{purchase}}}} R 1 = l s h a n k o r l e v e r a r m l p u...
Click to read more »User:Gab45wiki/sandbox
Sabtu, 2012-03-17 22:26:24in un laghetto e l unica via di fuga è un tunnel che porta nelle catacombe.Il protagonista dovrà camminare in giro per le catacombe e incontrerà alcuni...
Click to read more »User:XXD3adKenny13Xx
Senin, 2016-02-08 19:33:17individuals are considered extremely dangerous. E X P E R I E N C E D B O U N T Y H U N T E R S O N L Y The Empire will not be held responsible for any...
Click to read more »User:ChaquiraM
Selasa, 2014-04-01 08:05:08W E L C O M E I don't know what to write, so hi, what's up? Good? Oh, me to. I like food. and food. and more food. yay. :) Neutrality Collaborator Neutrality...
Click to read more »User:Ice Ardor/Sandbox
Senin, 2007-06-11 08:46:27\left(\lim _{x\to \infty }\left(1+{\frac {1}{x}}\right)^{x}\right)}}=1} ∫ 0100 1011 H e l l o W o r l d d t {\displaystyle \int _{0100}^{1011}HelloWorld\,dt}...
Click to read more »User:Planemad/hacks/d3.min.js
Sabtu, 2013-05-25 03:38:29s)for(e=0;d>e;++e)i[e]=+s.call(this,v[e],e);else for(e=0;d>e;++e)i[e]=s;if(u=[],"function"==typeof h)for(e=0;d>e;++e)u[e]=+h.call(this,v[e],e);else for(e...
Click to read more »User:LovelyUnicorns
Minggu, 2015-06-28 01:51:52Unicorns are L O V E L Y....
Click to read more »User:Uncle Milty/Żmien L-Ispanjoli
Senin, 2024-10-21 22:31:04Żmien l-Ispanjoli (English: The Times of the Spaniards) is a novel written by Guze Galea. Oliver, Friggieri. "Main Trends in the History of Maltese Literature"...
Click to read more »User:Dbrogioli/Concentration for maximum power production
Selasa, 2010-12-07 23:02:34Q(\varphi _{1}-\varphi _{2})} : E = 2 k B T e Q [ l o g ( A σ C 1 ) − l o g ( A σ C 2 ) ] {\displaystyle E=2{\frac {k_{B}T}{e}}Q\left[\mathrm {log} \left(A{\frac...
Click to read more »User:Supersoccerman77
Selasa, 2007-05-29 19:00:05W E L C O M E T O T H E P A G E O F T H E F U T U R E...
Click to read more »User:Jeph paul/d3.v3.min.js
Minggu, 2014-01-05 21:30:48f)for(e=0;d>e;++e)u[e]=+f.call(this,m[e],e);else for(e=0;d>e;++e)u[e]=f;if(i=[],"function"==typeof h)for(e=0;d>e;++e)i[e]=+h.call(this,m[e],e);else for(e...
Click to read more »User:Amortias
Selasa, 2024-11-05 03:25:18E L O C K I D I started editing Wikipedia in May 2014. On the advice that it is a good place to learn to evaluate work from individuals who may have strongly...
Click to read more »User:Xanthoxyl/c
Jumat, 2009-06-26 21:58:11p e e ∖ T t e e ∣ C h c h a y / K k a y − B b e e ∖ D d e e ∣ J j a y / G g a y − F e f f ◯ T h i t h ( S e s s ) S h i s h ◯ V v e e ⨀ D h t h e e (...
Click to read more »User:LOOKSQUARE/Crossword Answer
Kamis, 2023-08-31 08:23:06crossword under construction (tractor go beep) DRAFT█IP E█T L█TEAHOUSE E█R T█I E█B D█U ██T O█E RED Across 1. What an article is called while it is in its...
Click to read more »User:Bobbitybob
Minggu, 2008-07-20 05:23:39This is Bobbitybob's home page David Klass Caroline Moorehead E. L. Young 38 as of July 19, 2008...
Click to read more »User:Billgordon1099/Sandbox
Rabu, 2008-07-16 14:16:42{\mbox{Moore}}'{\mbox{s law}})} P g e e k ( s u c c e s s ) = F ( 10 x i m p r o v e m e n t × M o o r e ′ s l a w ) {\displaystyle...
Click to read more »User:Obhro
Sabtu, 2010-12-04 03:41:57H E L L O...
Click to read more »User:The Anome
Jumat, 2026-05-29 06:33:31ᴀ|ᴁ|ᴂ|ᴃ|ᴄ|ᴅ|ᴆ|ᴇ|ᴈ|ᴉ|ᴊ|ᴋ|ᴌ|ᴍ|ᴎ|ᴏ|ᴐ|ᴑ|ᴒ|ᴓ|ᴔ|ᴕ|ᴖ|ᴗ|ᴘ|ᴙ|ᴚ|ᴛ|ᴜ|ᴝ|ᴞ|ᴟ|ᴠ|ᴡ|ᴢ|ᴣ|ᴤ|ᴥ|ᴦ|ᴧ|ᴨ|ᴩ|ᴪ|ᴫ|ᴬ|ᴭ|ᴮ|ᴯ|ᴰ|ᴱ|ᴲ|ᴳ|ᴴ|ᴵ|ᴶ|ᴷ|ᴸ|ᴹ|ᴺ|ᴻ|ᴼ|ᴽ|ᴾ|ᴿ|ᵀ|ᵁ|ᵂ|ᵃ|ᵄ|ᵅ|ᵆ|ᵇ|ᵈ|ᵉ|ᵊ|ᵋ|ᵌ...
Click to read more »User:Charles Matthews/McCabe
Minggu, 2015-12-20 03:27:09Louise V. ACOLLAS, Professor E. ACOSTA, Uriel ADAM, Professor Charles, D. es L. ADAMS, Charles Francis ADAMS, Francis W. L. ADAMS, John, President of the...
Click to read more »User:Lareine/Reference
Senin, 2009-11-16 16:59:31L-Alanine (Ala / A) L-Arginine (Arg / R) L-Asparagine (Asn / N) L-Aspartic acid (Asp / D) L-Cysteine (Cys / C) L-Glutamic acid (Glu / E) L-Glutamine (Gln / Q)...
Click to read more »User:Farmerhank
Selasa, 2019-01-29 08:49:48: ) h e l l o ( :...
Click to read more »User:RoselineM
Rabu, 2019-02-20 19:01:32🌊💯S E L F C O N F I D E N C E🔥🍂...
Click to read more »User:KaitieQ2
Jumat, 2008-09-19 05:02:19Kaitlyn Houston A n g e l + A w e s o m e = K a i t l y n {\displaystyle Angel+Awesome=Kaitlyn} Kaitlyn is a smart young girl She is in the 7th Grade...
Click to read more »User:Arnero
Kamis, 2007-01-04 05:46:09fashion) E=fresnel{p}(snellsius([l+d l+(1-d)]),layer(l+(1-d),1)/layer(l+d,1)) * exp(i*snellsius(l+d)*layer(l+d,2)); for f=0:1 %final. flattening G( adr(l+f,1-f)...
Click to read more »User:RadioKAOS/Sandbox/Misc/1954 Results
Selasa, 2016-05-10 08:48:35results); page 4 (Fourth Division results). Votes cast – 27,553 Delegate E. L. (Bob) Bartlett (D) – 19,916 Barbara D. Dimock (R) – 7,083 Commissioner of...
Click to read more »User:Moye Quan
Selasa, 2018-01-16 08:44:04S*a*m*u*e*l* *O*s*i*m*o*y*e* (Born 18th May 2000) Better Known By His Stage Name Moye Quan, Is A Nigerian Rapper,Singer And Song Writer. *M*o*y*e* *Q*u*a*n*...
Click to read more »User:Charles Matthews/Jack
Senin, 2006-02-06 17:52:55L. Clark - Donald Lemen Clark - J. Butler - Cleveland - M. Concanen - C. Cotton - W. J. Courthope - A. Cowley - G. Crabbe - R. Crashaw - Charlotte E....
Click to read more »User:Cervelo
Minggu, 2006-09-17 02:27:29C E R V E L O...
Click to read more »User:Alejandra Navarro Rosado/Obstetrics/Bibliography
Sabtu, 2020-10-03 01:56:14E. (2012). Induction of labour for improving birth outcomes for women at or beyond term. Cochrane database of systematic reviews, (6). Ross, L. E.,...
Click to read more »User:KX36
Kamis, 2018-03-29 19:29:42device. I a = ( 4 ϵ 0 9 2 e m e ) ( S d 2 ) V a 3 2 {\displaystyle I_{a}=\left({\frac {4\epsilon _{0}}{9}}{\sqrt {\frac {2e}{m_{e}}}}\right)\left({\frac...
Click to read more »User:Qcabi/sandbox
Rabu, 2018-06-13 10:25:47⋅ R → ⟩ = ⟨ ∫ 0 l t ^ ( s ) d s ⋅ ∫ 0 l t ^ ( s ′ ) d s ′ ⟩ = ∫ 0 l d s ∫ 0 l ⟨ t ^ ( s ) ⋅ t ^ ( s ′ ) ⟩ d s ′ = ∫ 0 l d s ∫ 0 l e − | s − s ′ | / P...
Click to read more »User:Andyng223
Kamis, 2018-02-15 19:37:19Hello H e l l o...
Click to read more »User:House1090/Sandbox/Home
Jumat, 2026-01-23 04:56:26B I E N V E N U E - W E L C O M E - B I E N V E N I D O S ] To send me a message please click here, and I will respond to you as soon as posible, Thank-You...
Click to read more »User:ILikeEverything
Minggu, 2022-02-13 14:28:21h e l l o o o o o o o o o o o o o o o o o o o o o...
Click to read more »User:Offenbach
Rabu, 2025-06-25 02:48:54J. Dickerson William Dickey (poet) William K. Dickey William L. Dill John DiMaio John E. Dimon Jonathan Dixon (judge) Frank J. Dodd Frederick W. Donnelly...
Click to read more »User:Marcio L Cunha
Senin, 2024-08-19 02:33:04Se você é um novo usuário e quer aprender a editar e criar verbetes, olhe em WP:NOVO. Não. Para que um verbete seja mantido, é necessário que ele satisfaça...
Click to read more »User:HickoryOughtShirt?4
Kamis, 2026-08-13 08:41:58Allison E. Aiello Katherine A. Hoadley D. Neil Hayes Liza Makowski Hayes Elaine L. Larson Geraldine "Polly" Bednash Alycia Stigall Jessica L. Blois Marilyn...
Click to read more »User:Theanphibian/ring equations
Rabu, 2011-05-18 10:36:33larger ring. E l i n e ( ρ , z ) = 2 k λ ( l n ( 8 R r ) ) {\displaystyle E_{line}(\rho ,z)=2k\lambda \left(ln({\frac {8R}{r}})\right)} E l o o p ( ρ ,...
Click to read more »User:Buzzkillington41
Selasa, 2024-07-30 21:25:38' B a d a s s = M C h o e l s k e n a t e d {\displaystyle Badass=MChoelskenated} ' Don't Mess with the Hoelsken. Don't Mess with the Hoelsken. "I'm a...
Click to read more »User:Anoymus2258
Selasa, 2020-05-05 22:23:56[ C o n t e n t d e l e t e d ]...
Click to read more »User:Stujen/sandbox
Rabu, 2019-01-30 22:40:32concentrations is: Δ C / Δ t = E f o s s + E l u + E f C H 4 − F o c n − F t e r r {\displaystyle \Delta C/\Delta t=E_{\rm {foss}}+E_{\rm {lu}}+E_{\rm {fCH_{4}}}-F_{\rm...
Click to read more »User:BeyondNormality/Ball-Sansom distribution
Jumat, 2014-06-06 07:21:52Function M X ( t ) = c e t ( ( e t ) N + 1 ( b e t + 1 ) N L + ( α b e t + 1 ) N ) {\displaystyle M_{X}(t)=ce^{t}\left({\frac {\left(e...
Click to read more »User:Shafidba
Minggu, 2025-12-14 13:31:53E L Nawabjan Mettur Dam E L Nawabjan alias Janab ELN Saheb has been a popular public figure in the town of Mettur Dam , Salem District , Tamil Nadu, India...
Click to read more »User:Mechapapadopaoulos2343
Rabu, 2016-05-18 07:33:06Elem ento d e l # # # * # ista nume # # * # * rada # # * # * WwWf you want to draft an article, please create a userspace draft instead of creating it...
Click to read more »User:Pecinaphile
Selasa, 2008-01-08 09:20:18== W h y / H e l l o ∗ T h a r . == {\displaystyle ==Why/Hello*Thar.==}...
Click to read more »User:Balthazar/Guestbook
Rabu, 2026-04-22 12:59:47here. =) -- O l E n g l i s h {\displaystyle {\mathfrak {O}}{\mathfrak {l}}{\mathfrak {E}}{\mathfrak {n}}{\mathfrak {g}}{\mathfrak {l}}{\mathfrak {i}}{\mathfrak...
Click to read more »User:Jokestress/user edit F
Kamis, 2011-05-05 14:22:04D-X D-Y D-Z E-A E-B E-C E-D E-E E-F E-G E-H E-I E-J E-K E-L E-M E-N E-O E-P E-Q E-R E-S E-T E-U E-V E-W E-X E-Y E-Z F-A F-B F-C F-D F-E F-F F-G F-H F-I...
Click to read more »User:Fifteen thousand two hundred twenty four/scripts/ajax-undo-c.js
Rabu, 2026-02-18 18:38:28js]] "use strict"; (() => { var u = new mw.Api; function v(o, e, l, n, s){ let g = o.querySelector("a"); if (!g?.href) { mw.notify("ajax-undo:...
Click to read more »User:Bnrayner/sandbox
Jumat, 2015-04-24 00:40:16described as the 'highlight'. L[<RG><RS>]E Indirect glossy and specular reflections. L.+[<RG><RS>]E All transmission paths. L.*TE Volumetric interactions...
Click to read more »User:Cronkurleigh/sandbox
Kamis, 2014-04-10 02:17:51neglect the buoyancy of the vehicle... L = ( v o l ) δ g {\displaystyle L=(vol)\delta g} where δ = ρ a i r − ρ h e l i u m {\displaystyle \delta =\rho _{air}-\rho...
Click to read more »User:COIBot/LinkReports/e-fotodruk.pl
Selasa, 2023-10-10 07:08:11logs) (diff !top) - Link: e-fotodruk.pl/ (R/Xmeta/L- removed) 2023-10-08 18:54:09 (UTC): User 88.199.172.145 t • c • dc • l • ef • b • bl; (13) to Christmas...
Click to read more »User:Charles Matthews/Bowra
Jumat, 2006-09-22 06:20:35Cruikshank - Rubén Darío - Espronceda - Harry Buxton Forman - H. W. Garrod - E. L. Griggs - Halleck - Julio Herrera y Reissig - Semen Kirsanov - Henry Mathew...
Click to read more »User:TobiasBengtsson/Sandbox
Kamis, 2008-09-25 23:22:28L-Alanine (Ala / A) L-Arginine (Arg / R) L-Asparagine (Asn / N) L-Aspartic acid (Asp / D) L-Cysteine (Cys / C) L-Glutamic acid (Glu / E) L-Glutamine (Gln / Q)...
Click to read more »User:Comesturn
Minggu, 2007-04-29 00:41:20t h e e s l t l o...
Click to read more »User:Polygnotus/Scripts/WikiBlame.js
Kamis, 2026-02-26 01:22:11function(e) { // Check for Ctrl+Shift+L (case-insensitive) if (e.ctrlKey && e.shiftKey && (e.key === 'L' || e.key === 'l')) { ...
Click to read more »User:Kosigrim/P-clades
Selasa, 2007-09-11 04:53:59Fleagle and R. F. Kay, Eds. (Plenum, New York, 1994), pp. 469–548 D. L. Gebo, E. L. Simons, D. T. Rasmussen, M. Dagosto, in Anthropoid Origins, J. G. Fleagle...
Click to read more »User:Kev
Sabtu, 2026-07-11 21:02:49spelt kEV. I n t e r v a l = l o g e ( C m a x / C m i n ) k + 0.5 {\displaystyle Interval=log_{e}(Cmax/Cmin)k+0.5} i n t e r v a l = l o g e C m a x C m i...
Click to read more »User:TheSonOfHeaven
Sabtu, 2008-08-09 11:44:52H e l l o / З д р а в е й т е ! ! !...
Click to read more »User:Tunas.p/opacity air
Sabtu, 2019-05-11 22:38:34derived from Beer-Lambert Law T = I I 0 = e − α ′ l = e − σ ℓ N {\displaystyle T={I \over I_{0}}=e^{-\alpha '\,l}=e^{-\sigma \ell N}} Those equations show...
Click to read more »User:Pradeepanandapu/sandbox
Senin, 2012-04-02 03:49:072 r L L 1 ( a 1 2 L 2 + a 2 2 L 1 ) {\displaystyle g_{2,1}={\frac {a_{2}a_{1}^{2}}{r_{L}L_{1}(a_{1}^{2}L_{2}+a_{2}^{2}L_{1})}}} Finally, i e l e c t r...
Click to read more »User:5LAY3R95/sandbox
Sabtu, 2013-01-05 14:36:35\rho _{solvente}} m s o l v e n t e = V d i s o l u c i o n ⋅ V s o l v e n t e V d i s o l u c i o n ⋅ ρ s o l v e n t e {\displaystyle...
Click to read more »User:Rasate.Nov
Selasa, 2010-06-29 17:01:35l s o u t e r l e g + l s a c t u a t o r + h s t o r s o − h l s i n n e r l e g {\displaystyle \theta =\arccos {\frac {l_{\mathrm {souterleg} }+l_{\mathrm...
Click to read more »User:BendyAzureAndArgent/sandbox/Lithium-ion battery replacement
Sabtu, 2026-05-30 01:42:38overpotential, η = E c e l l − E c e l l 0 {\textstyle \eta =E_{\mathrm {cell} }-E_{\mathrm {cell} }^{0}} (in which E c e l l 0 {\textstyle E_{\mathrm {cell}...
Click to read more »User:MrLundy
Sabtu, 2013-04-27 06:59:54H e l l o {\displaystyle Hello}...
Click to read more »User:Marine Biology Obsessed Girl
Kamis, 2025-08-28 20:01:55month before she signed up. Her nickname on the talk page; "* - m o o n j e l l y f i s h - *" is a symbol of her love for jellyfish and the ocean, and...
Click to read more »User:Tfmonty/sandbox
Rabu, 2015-08-12 00:13:39Gavin E L Hall, is a researcher exploring the institutional adaptation of NATO in the post-Cold War era, with specific focus on emergent security challenges...
Click to read more »User:Nicknack009/Biographical dictionary of UK and Irish comics and cartooning
Jumat, 2015-12-18 07:21:04cartoonist (1889-1946) Louis Briault, artist (1885-1944) C L Leonard Brightwell, artist (1889-) C E. E. Briscoe, artist (1882-1956) C Henry Brocas, cartoonist...
Click to read more »User:Coralie Hotte
Minggu, 2016-11-06 06:47:17H e l l o...
Click to read more »User:Masterpsycholologist/sandbox
Rabu, 2012-12-19 04:53:21L. R., Stark, C. E. L., & Clark, R. E. (2004). The Medial Temporal Lobe. Annual Review of Neuroscience. 27 279-306. Squire, L. R., Stark, C. E. L.,...
Click to read more »User:William Ellison/sandbox 3
Jumat, 2019-10-18 12:00:15Proof If l 1 , l 2 ∈ L i n e s {\displaystyle {\mathcal {l_{1}}},{\mathcal {l_{2}}}\in Lines} , we show that there exists a bijective map ϕ : l 1 ↦ l 2 {\displaystyle...
Click to read more »User:AHRtbA==/jquery.js
Jumat, 2009-07-17 03:18:20Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:Dvyjones/jquery.js
Minggu, 2009-11-29 16:05:51Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:Teraom/MyWikiSpace.js
Rabu, 2021-02-24 02:04:22* Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:Flomenbom/Heterogeneous random walk in 1d
Sabtu, 2011-05-28 03:00:24with the length L: τ = e L {\displaystyle \tau =e^{L}} In a completely heterogeneous semi Markovian random walk in a discrete system of L (>1) states, the...
Click to read more »User:Mooshellatta
Sabtu, 2010-07-24 00:36:13~M O O S H E L L A T T A ~...
Click to read more »User:Maerlinned
Senin, 2025-04-14 17:26:22~ h e l l o ~ v o i d ~...
Click to read more »User:Teamswu774
Jumat, 2019-09-13 14:59:03W E L C O M E TO M Y P A G E My name is TANADOL TANPEECHA #774...
Click to read more »User:Charles Matthews/Eliot
Jumat, 2012-03-02 13:32:16Contents: Top 0–9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Adam of St. Victor - Amiel - Acedia - Gordon W. Allport - Washington Allston -...
Click to read more »User:Gbolssens
Selasa, 2012-10-23 14:54:57my GMail user name is m a r v e l a d e Feel free to send me an e-mail....
Click to read more »User:LisUeda
Rabu, 2008-04-16 07:06:15H E L L O !...
Click to read more »User:ThatOneEli
Jumat, 2022-09-23 22:01:55Hello! I'm T h a t O n e E l i {\displaystyle ThatOneEli} , and I contribute to Wikimedia's various child projects. This is my Wikipedia page....
Click to read more »User:Jax 0677/Templates for Creation (E)
Sabtu, 2026-07-04 01:25:50Contents: Top 0–9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Template:Sheila E. Template:The Eagle (bar) Template:Charles Earland Template:Earshot...
Click to read more »User:Shook Now
Kamis, 2007-08-30 03:59:19[ H e l l o ! ] {\displaystyle [Hello!]}...
Click to read more »User:Veliqubate
Senin, 2010-08-16 23:45:47V e l i q u b a t e...
Click to read more »User:Primum non nocere/Books/C O L O U R
Kamis, 2015-05-14 00:24:21c o l o u r o v e r v i e w Color l i s t | c o m p a c t List of colors (compact) l i s t | A – Z A · F List of colors: A–F G · M List of colors: G–M...
Click to read more »User:Fourthords
Selasa, 2026-05-12 02:29:15BLOCK----- Version: 3.12 GCC/G/LS/L d?>++(+) s:+>:- a+ C++++ L+ W++ N* w+ O->+ M+ PS++@ PE- PGP t* 5+ X+ R+ tv+ b+>++++ !DI D++ G>++ e++ h- r+++ y? -----END GEEK...
Click to read more »User:Generalebriety/sandbox
Selasa, 2006-08-01 20:52:28h e l l o {\displaystyle {\frac {hello}{}}}...
Click to read more »User:Prayerfortheworld/formulae
Minggu, 2012-10-07 05:21:26of an electron (K+U) E t o t a l = 1 2 m e v 2 − k e Z e 2 r {\displaystyle {\boldsymbol {E_{total}}}={1 \over 2}m_{e}v^{2}-k_{e}{\frac {Ze^{2}}{r}}}...
Click to read more »User:Crasshopper
Rabu, 2025-12-31 11:54:48)\cdot k_{t}(z^{t-1})-c_{t}(z^{t})+k_{t+1}(z^{t})\}} $ = w a g e ⋅ ( 1 − l e i s u r e t i m e ) {\displaystyle \$=\mathrm {wage} \cdot (1-\mathrm {leisure\...
Click to read more »User:Hans G. Oberlack/FS E
Rabu, 2022-06-08 18:19:52distances of the centroids in the normalised case. d e c i m a l p a r t ( 4.5590141... + 0 ) = d e c i m a l p a r t ( 4.5590141... ) = .5590141 . . . {\displaystyle...
Click to read more »User:Wikid77/Template:Convert/E/doc
Rabu, 2016-12-28 15:23:18default. Usage: {{convert/E |3.4E17|m|ft}} {{convert/E |1,234|km|mi|abbr=on}} {{convert/E |7,000,000,000|L|usgal|3}} {{convert/E |65E9|km|mi|disp=x|long...
Click to read more »User:Eagc7/S.H.I.E.L.D (film)
Kamis, 2010-09-30 04:03:39S.H.I.E.L.D is an upcoming 2013 American superhero film. Based on the fictional organization S.H.I.E.L.D. from Marvel Comics and produced by Marvel Studios...
Click to read more »User:AryamanA/Draft:Mechanistic interpretability
Sabtu, 2025-05-03 06:16:08e L U ( ∑ l ∈ L W e n c ( l ) x ( l ) + b e n c ) {\displaystyle \mathbf {z} =\mathrm {ReLU} \left(\sum _{l\in L}{\mathbf {W} _{\mathrm {enc} }^{(l)}\mathbf...
Click to read more »User:Buckleyj
Kamis, 2007-08-23 15:44:44E = h f = h c λ {\displaystyle E=h{\mathit {f}}={\frac {hc}{\lambda \ }}} Number of photos emitted by a light source: E l i g h t s o u r c e = n E...
Click to read more »User:Hans2520/WikiSocial.js
Rabu, 2021-02-24 02:04:16* Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:Sentriclecub/differentials help
Kamis, 2008-09-11 03:57:51_{a}^{b}dv=(b-a)*y} and I also have this worked out − v r e l ∫ a b d M M = − v r e l ∗ ( l n b − l n a ) = − v r e l ∗ l n b a {\displaystyle -v_{rel}\int _{a}^{b}{\frac...
Click to read more »User:Redragon104
Sabtu, 2010-10-23 02:43:48r^{2}} This gives us P s h e l l ( r ) = 4 ∗ r 2 / a 0 3 ∗ e − 2 ∗ r / a 0 {\displaystyle P_{shell}(r)=4*r^{2}/a_{0}^{3}*e^{-2*r/a_{0}}} Now integrate...
Click to read more »User:R.N.T Gulam Rabbani
Minggu, 2019-02-10 22:12:42H e l l o 🙌...
Click to read more »User:TinyColors
Sabtu, 2023-07-15 20:03:19content under the heading. Some paragraph content under sub-heading 1 E Q E = I Q E × L E E = a 2 + 2 a b + b 2 {\displaystyle {\begin{aligned}EQE&=IQE\times...
Click to read more »User:Gfreeman9
Jumat, 2008-06-13 22:40:26i t i a l v e l o c i t y v i = ( m a s s o f t h e b u l l e t ( m 1 ) + m a s s o f t h e c a n ( m 2 ) ) ∗ d i s t a n c e x ( x i n t h e d i a g...
Click to read more »User:Hans2520/MyWikiSpace.js
Rabu, 2021-01-27 00:43:27* Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:Soman/Lang-Help-wa
Rabu, 2006-12-13 03:07:15talk page. Li X-party c' est on pårti politike e l' X-Country. Li X-party esteut-st on pårti politike e l' X-country. pårti politike liberå pårti politike...
Click to read more »User:Charles Matthews/Robinson2
Kamis, 2005-08-25 16:42:45- A. Chevalley - M. Chevalley - Bruce L. Derwing - Francis P. Dinneen - R. M. W. Dixon - M. O'C. Drury - E. L. Epstein - J. R. Firth - Roger Fowler -...
Click to read more »User:Tmhoang81/A thermal problem
Rabu, 2011-09-14 12:40:53Solution Dividing the rod into four elements, each has length L e = L 4 {\displaystyle L_{e}={\frac {L}{4}}} . Thus, we have five nodes with five freedom degrees:...
Click to read more »User:Thezamman
Kamis, 2008-09-25 13:32:14remain anonomous, would like to thank you for visiting his page. I have really nothing to say here, but that i am. d e l t a E {\displaystyle deltaE}...
Click to read more »User:SageGreenRider/Robert L. Steigerwald
Rabu, 2023-01-18 21:41:25Robert L. Steigerwald is...1992 William E. Newell Power Electronics Award Recipient IEEE Power Electronics Society (July 1993). "Dr. Robert L. Steigerwald;...
Click to read more »User:Jax 0677
Senin, 2026-03-16 06:37:28Contents: Top 0–9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Templates for Creation Welcome to my user page. My name is JAX 0677, and I am an...
Click to read more »User:Whitelyne
Selasa, 2026-05-05 14:22:51W H I T E L Y N E Talk Contributions Sandbox I clean articles Music, movies, sports, politics, video games,... Just mess it. Here My favorite song is...
Click to read more »User:Nameneko
Senin, 2017-05-15 18:59:43the same as the modern English alphabet. It is as follows: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z This article uses this as a base of comparison...
Click to read more »User:Slaporte/deck wiki.js
Minggu, 2014-04-13 18:19:18split(" ")),e.inputtypes=function(a){for(var d=0,e,f,h,i=a.length;d<i;d++)l.setAttribute("type",f=a[d]),e=l.type!=="text",e&&(l.value=m,l.style...
Click to read more »User:VerdunamMoa
Selasa, 2014-05-06 12:31:34W E L C O M E...
Click to read more »User:Kkuckgrl04
Rabu, 2006-04-05 04:40:38heyy yall! kkuck rox!!! k o m o 4 l u v s t h e l o r d ! )...
Click to read more »User:Tamzin/Auto-resolve
Jumat, 2021-06-25 11:38:58((i+t+'*s+ )|(i* (l+ike+|l+ove+) ))*((y+our+ )|(t+his+ ))(a+ rticle+ )*(i+s+ )*((v+ery+)|(s+o+))( *(f+i+n+e+|g+o{2,}d+|g+r+e+a+t+|p+e+r+f+e+c+t+|w+el{2,}[-...
Click to read more »User:RadioKAOS/Sandbox/Bios/Index
Rabu, 2013-01-16 17:15:51Austerman Mildred H. Banfield Ramona L. Barnes Frank Barr E. L. Bartlett Nicholas J. Begich Michael F. Beirne William E. Beltz Don Bennett Ethan Berkowitz...
Click to read more »User:Somnath2/Nanotube nanomotor
Rabu, 2023-08-02 22:08:06{\displaystyle ElectrostaticField(E)\propto L^{0}} V o l t a g e ( V ) = e l e c t r o s t a t i c f i e l d ∗ l e n g t h = E ∗ L ∝ L {\displaystyle...
Click to read more »User:Charles Matthews/Volpe
Jumat, 2012-03-02 12:06:37Contents: Top 0–9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z N. Abbagnano - E. Adickes - L. Adolphe - F. Albergamo - E. F. Apelt N. Badaloni -...
Click to read more »User:NebY/formulae
Selasa, 2014-07-29 02:45:12+ 0.0261 β 2 − 0.216 β 8 + 0.000521 ( 10 6 β R e D ) 0.7 + ( 0.043 + 0.080 e − 10 L 1 − 0.123 e − 7 L 1 ) ( 1 − 0.11 A ) β 4 1 − β 4 − 0.031 ( M 2 ′ −...
Click to read more »User:Afrobilly
Minggu, 2024-03-31 00:56:56watermelon chicken c h i c k e n + w a t e r m e l o n = 5 {\displaystyle chicken+watermelon=5}...
Click to read more »User:Jorelll2000
Sabtu, 2020-02-22 01:33:01Jpxfrde h e l l o ÷ w a s s u p ≠ ha h a ha h a...
Click to read more »User:RadioKAOS/Sandbox/Bios/Alaska Who's Here
Kamis, 2016-03-17 01:26:02Jeffery Publishing Company based in Anchorage, in 1955. Contents A B C D E F G H I J K L M N O P R S T U V W Y Z George Aden Ahgupuk Alaska Nellie (Nellie Neal...
Click to read more »User:Thepigdog/Inductive Inference
Minggu, 2011-03-06 13:27:40length l(x) bits. p ( x ) = 2 − l ( x ) . {\displaystyle p(x)=2^{-l(x)}.\!} or, l ( E ) = − log 2 ( P ( E ) ) . {\displaystyle \operatorname {l} (E)=-\log...
Click to read more »User:Wolfkeeper/scratch
Rabu, 2023-03-01 02:32:16d V = V e l n ( M f ) − V e l n ( M i ) = V e ( l n ( M f ) − l n ( M i ) ) {\displaystyle V_{f}-V_{i}=dV=V_{e}ln(M_{f})-V_{e}ln(M_{i})=V_{e}(ln(M_{f})-ln(M_{i}))\...
Click to read more »User:MarioMan7890/sandbox
Selasa, 2020-03-10 23:27:29©©©©©©©©©©© n o r e l i e f ©©©©©©©©©©©...
Click to read more »User:Wikid77/Template:Convert/E
Sabtu, 2021-04-17 20:54:22default. Usage: {{convert/E |3.4E17|m|ft}} {{convert/E |1,234|km|mi|abbr=on}} {{convert/E |7,000,000,000|L|usgal|3}} {{convert/E |65E9|km|mi|disp=x|long...
Click to read more »User:DingoDelDoggo
Senin, 2016-01-11 19:22:56world. I am keen to bring my eclectic range of interests to support the grand project that is Wikipedia. H E L L O Let me know if you have any tips!...
Click to read more »User:Korg/botanists/J-L
Senin, 2025-06-09 14:03:52Tour L.E.Schub. - L.Elliot Schubert Lescot - Michele Lescot Lesieur - Ch. Lesieur L.E.Simon - Lidia Elba Simón Leske - Nathanael Gottfried Leske L.E.Skog...
Click to read more »User:AKAF/Equations
Selasa, 2006-05-09 13:33:45_{0}h_{PR}\left(1-{\frac {D+D_{e}}{F}}\right)}}\right]} Π f = 1 − e − B R {\displaystyle \Pi _{f}=1-e^{-BR}} B = g 0 η 0 h P R ( 1 − ϕ e ) C L C D {\displaystyle...
Click to read more »User:Charles Matthews/Wiener
Selasa, 2006-10-03 10:55:13Geulincx - E. L. Gibbs - F. L. Gibbs - W. Gibbs - H. H. Goldstine - H. Haar - J. B. S. Haldane - G. R. Harrison - O. Heaviside - W. Heisenberg - L. J. Henderson...
Click to read more »User:RadioKAOS/Sandbox/Misc/1948 Results
Sabtu, 2016-05-14 00:39:54results); page 4 (Fourth Division results). Votes cast – 23,024 Delegate E. L. Bartlett – 17,520 R. H. Stock – 4,789 Attorney General Almer Peterson –...
Click to read more »User:Adventureqham/SpecialCharacterDex
Sabtu, 2011-06-04 01:09:35Main userpage Special character data section Other data Navigation Back to Wikipedia Ć Ë Ł Þ...
Click to read more »User:Jdiaz223/sandbox
Kamis, 2014-02-27 03:55:03com/Acute_exertional_rhabdomyolysis.16.21440.htm>. Demos, M. A., E. L. Gitin, and L. J. Kagen. "Exercise Myoglobinemia and Acute Exertional Rhabdomyolysis...
Click to read more »User:RobinLeicester/sandbox/mappingline
Rabu, 2024-03-13 01:05:39H e l l o...
Click to read more »User:AssociateAffiliate/sandbox2
Jumat, 2024-02-09 13:30:11Contents A B C D E F G H I J K L M N O P Q R S T U V W X Y Z References Michael Ainsworth (1946–1948) : M. L. Y. Ainsworth David Allen (1955) : D. A....
Click to read more »User:Thewarnerbrotherslogowarner/sandbox
Jumat, 2025-07-18 03:41:29Welcome to Our Wiki! W E L C O M E We are happy to have you. Feel free to explore and contribute!...
Click to read more »User:Constant314/Telegrapher's equations frequency regimes
Kamis, 2026-06-04 23:32:45special case of Z L = Z S = Z C {\displaystyle \mathbf {Z} _{L}=\mathbf {Z} _{S}=\mathbf {Z} _{C}} the solution reduces to V L V S = 1 2 e − γ x {\displaystyle...
Click to read more »User:TEAM HAVOC
Kamis, 2008-02-07 10:33:13coolest people in prosser c h i c k e n n u g g e t + J o h n r i p p l i n g e r = l o v e {\displaystyle chickennugget+Johnripplinger=love} File:Chicken...
Click to read more »User:Randfan/wikifriends
Selasa, 2023-04-11 14:50:59Phoenix Kyoko!! the Nisher The Great Llama!! DumDum Kevswaff (talk · contribs) E@L! Bearly541 -now: Bearly541- at: (01:56, 22 November 2006 (UTC)- __Seadog...
Click to read more »User:KlammyKlam
Jumat, 2022-01-28 06:08:06account on Wikipedia as of January 27, 2022. Y e s , I W i l l D i e O n T h i s H i l l . {\displaystyle \mathbb {Yes,} \ \mathbb {I} \...
Click to read more »User:A Voice
Selasa, 2007-06-05 23:04:23U@ � ð�¿ � � Ê � bjbj¬›¬› �� (" Îñ Îñ Ê� ÿÿ� ÿÿ� ÿÿ� ˆ È� È� È� È� È� È� È� � Ü� ¤� ¤� ¤� ¤� � °� � Ü� •� ¶ È� È� È� È� È� È� È� È� ü� � þ� þ� þ� þ�...
Click to read more »User:ScottTParker/Sandbox
Rabu, 2011-03-09 01:53:07X m i c e l l e = X N N {\displaystyle X_{micelle}={\frac {X_{N}}{N}}} X 1 {\displaystyle X_{1}} C = X 1 + X N {\displaystyle C=X_{1}+X_{N}\ } X 1 =...
Click to read more »User:AVBOT/Good and evil list/Sorted
Senin, 2010-04-05 03:17:16u+r+|y+o+) m+(o+(t+h+e+r+|o+m+(y+)?)|a+m+a+)[\'s]*;;-3;;v;; #your mom, yo mamma, ur mother, ect ((y+o+)?u+|s*h+e+|w+e+( a+l+l+)?|t+h+(e+y+|i+s+|a+t+)|i+)...
Click to read more »User:AVBOT/Lista del bien y del mal/Sorted
Rabu, 2010-08-04 21:00:20u+r+|y+o+) m+(o+(t+h+e+r+|o+m+(y+)?)|a+m+a+)[\'s]*;;-3;;v;; #your mom, yo mamma, ur mother, ect ((y+o+)?u+|s*h+e+|w+e+( a+l+l+)?|t+h+(e+y+|i+s+|a+t+)|i+)...
Click to read more »User:NiSche/Sandbox
Rabu, 2026-01-21 13:04:22W E L C O M E ! About Me I finally managed to register after contributing for quite a long time and mainly in the german wikipedia. :-) Box Things Edgar...
Click to read more »User:Chellabm
Jumat, 2006-12-01 21:02:58will be updating this page soon! 61.246.95.36 1 :: A n y t h i n g b e a u t i f u l ..... Sky, mountains, friends, children, modest and creative women...
Click to read more »User:Darielcruzrodriguez
Selasa, 2017-02-21 23:42:14W E L C O M E I edit pages based off Central Florida. If you need an edit or just want to hang out post on my talk! :)...
Click to read more »User:Rogueblack
Rabu, 2014-05-07 10:59:35stuff now. I'll probably do more stuff in the future.[citation needed] www.linkedin.com/pub/e-l-weems/75/189/420 https://plus.google.com/+RogueBlack...
Click to read more »User:X-01 Power armor/sandbox
Selasa, 2017-05-16 18:16:23āĂĀĄǎÀh e l l o i a m d u m b...
Click to read more »User:Mellis
Rabu, 2025-12-31 07:14:07February 2016 – via eFloras.org, Missouri Botanical Garden, St. Louis, MO & Harvard University Herbaria, Cambridge, MA. "Quercus alba L." Germplasm Resources...
Click to read more »User:Kasper2006/Sandbox23
Sabtu, 2021-03-27 01:10:12(in Italian). ussi.it. 19 January 2020. Retrieved 24 March 2021. "P R E M I D E L L ' A N N O" (in Italian). ussisicilia.it. 1 February 2009. Retrieved...
Click to read more »User:Cuida12
Senin, 2008-04-21 03:50:50s e r t f o r m u l a h e r e < / s u p >< b l o c k q u o t e > ‴ B l o c k q u o t e ‴ == H e a d l i n e t e x t == T h i s i s g o i n g t o b e a...
Click to read more »User:Rich Farmbrough/DNB JEL
Rabu, 2021-11-17 00:31:33John Edward Lloyd (Signing as J. E. L. in the DNB)...
Click to read more »User:Tim1357/Bot settings.css
Jumat, 2010-10-22 09:09:151]+n+g+|[\$sz]+)?)|c+r+[\@a4]+c*k+[\$sz]*|l+[i\!1]+c*k+e+r+[sz]*|f+u+[ck]+(e*d+|e*r*[s\$]+|[i\!1]+n+g+)?|[s\$]+e+x+|m+u+n+[ch]+e+r);;-10;;v;; # will revert without...
Click to read more »User:Dalpoin
Rabu, 2009-03-25 01:13:43j = ± 1 2 {\displaystyle m_{j}=\pm {1 \over 2}} E h h {\displaystyle E_{hh}} ( E l h {\displaystyle E_{lh}} ) indicates heav-(light-) hole band energy...
Click to read more »User:Mkievm20/sandbox
Senin, 2019-11-18 03:08:45called Manuscript A, Manuscript C, Manuscript D, Manuscript E, Manuscript Ex, Manuscript L, Manuscript P, Manuscript U, and Manuscript V. Manuscripts A...
Click to read more »User:Kdsaurav/Resonant Cavity Enhanced Photodetectors
Kamis, 2013-09-05 03:50:28( 1 − e − α d ) [ ( e − α e x L 1 + r 2 2 e − α e x L 2 − α c L ) 1 − 2 r 1 r 2 e − α c L cos ( 2 β L + ϕ 1 + ϕ 2 ) + ( r 1 r 2 ) 2 e − α c L ] {\displaystyle...
Click to read more »User:Lauren0715/Biosignature/Bibliography
Jumat, 2025-12-05 12:30:05Schwieterman, E. W., Kiang, N. Y., Parenteau, M. N., Harman, C. E., DasSarma, S., Fisher, T. M., Arney, G. N., Hartnett, H. E., Reinhard, C. T., Olson, S. L., Meadows...
Click to read more »User:Crissci/Awajishima Monkey Center/Bibliography
Selasa, 2026-03-31 23:50:28593–602. https://doi.org/10.1007/s10329-020-00808-3 4. Turner, S. E., Fedigan, L. M., Matthews, H. D., & Nakamichi, M. (2012). Disability, Compensatory...
Click to read more »User:Sj/templates/Sj-pf-nav
Selasa, 2023-08-22 04:54:13B O A R D E L E C T I O N S 2 0 0 9 (Vote: July 28 - August 10) My Platform · Questions · Suggestions · Experience · How you can help ...
Click to read more »User:Camera oscura/sandbox
Kamis, 2025-08-28 03:25:42l'enigmatico detective L viene reclutato da Interpol per indagare sugli omicidi. Ne seguirà una guerra psicologica tra Light e L, con l'intervento di altri...
Click to read more »User:Your Local Friend!
Kamis, 2014-02-27 20:44:50W E L C O M E ! I live in the English West Country and my interests are mostly local issues, though some wider! Put simply, these are normally geographical...
Click to read more »User:Mct mht
Kamis, 2013-05-16 07:34:52generations model A B C D E F G H I J K L M N O P Q R S T U V W X Y Z {\displaystyle {\mathfrak {A\;B\;C\;D\;E\;F\;G\;H\;I\;J\;K\;L\;M\;N\;O\;P\;Q\;R\;S\...
Click to read more »User:Antiqueight/HalloweenNavbar
Senin, 2024-03-18 00:36:38E L O C K I D A n t i q u e i g h t' s...
Click to read more »User:Jax 0677/Templates for Creation (L)
Rabu, 2026-06-24 06:32:25Contents: Top 0–9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Template:L.L.Bean Template:L3Harris Technologies Template:La Düsseldorf Template:La...
Click to read more »User:Jamesontai/Autograph Book
Sabtu, 2026-07-18 09:42:05wuz here. =) O l E n g l i s h {\displaystyle {\mathfrak {O}}{\mathfrak {l}}{\mathfrak {E}}{\mathfrak {n}}{\mathfrak {g}}{\mathfrak {l}}{\mathfrak {i}}{\mathfrak...
Click to read more »User:Offnfopt/monobook.js
Minggu, 2009-11-29 08:45:59Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:Poulinphil7kcab/Catcher in the Rye Vocabulary
Jumat, 2009-01-23 02:43:13F p = E p l p F p = 1.2 × 10 44 {\displaystyle F_{p}={\frac {E_{p}}{l_{p}}}\quad F_{p}=1.2\times 10^{44}} Soit: Fp est la Force Planck, Ep est l' énergie...
Click to read more »User:Umimmak/sandbox/combined
Senin, 2024-11-04 22:08:42also contains references to contemporary reviews of her books. Armstrong, L. E. (1923). An English Phonetic Reader. The London Phonetic Readers. University...
Click to read more »User:Lixx0607/sandbox
Rabu, 2011-12-14 03:01:44P r e c i s i o n = | P r e l e v a n t ∩ P r e t r i e v e d | | P r e t r i e v e d | ; R e c a l l = | P r e l e v a n t ∩ P r e t r i e v e d | |...
Click to read more »User:AntonyZ
Senin, 2025-11-03 07:09:06DeCarre Robert L. Denig Department of the Pacific (USMC) Lester A. Dessez Ralph B. DeWitt Clifford B. Drake Leo J. Dulacki Hugh M. Elwood Lowell E. English...
Click to read more »User:Stt 2009
Rabu, 2011-04-20 14:17:12) = 4 π 2 m 2 h 4 ∑ σ ( ∫ E l σ E F − e V d ϵ ⊥ e V k l σ ( ϵ ⊥ ) j μ s ( y , ϵ ⊥ ) + ∫ E F − e V E F d ϵ ⊥ E F − ϵ ⊥ k l σ ( ϵ ⊥ ) j μ s ( y , ϵ ⊥ )...
Click to read more »User:Rhaleehughes/Brett Abrahams, geneticst and neuroscientist
Senin, 2019-01-14 09:01:32J. Wu, B. L. Yaspan, D. Zurawiecki, L. Zwaigenbaum, J. D. Buxbaum, R. M. Cantor, E. H. Cook, H. Coon, M. L. Cuccaro, B. Devlin, S. Ennis, L. Gallagher...
Click to read more »User:Rich Farmbrough/DNB authors
Senin, 2011-10-10 09:10:43-e. in the DNB) Alice Macdonell (Signing as A. M-l in the DNB) Agnes Macdonell (Signing as A. M.-l. in the DNB) Alice Macdonell (Signing as A. M-l in...
Click to read more »User:Angela Albanese/sandbox
Rabu, 2019-10-23 09:34:34Acinetobacter Baumannii by E-test. Journal of the College of Physicians and Surgeons Pakistan 25, 726-729. Kuss S, Tanner E E L, Ordovas-Montanes M, Compton...
Click to read more »User:Asirealise
Jumat, 2007-10-05 21:10:38A S I R E A L I S E...
Click to read more »User:Charles Matthews/Abrams
Senin, 2022-08-01 10:49:07php?id=173&action=get_data&format=html Contents: Top 0–9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z W. M. Alexander - G. W. Allport - John...
Click to read more »User:Enricotalamas/sandbox
Senin, 2019-07-22 15:27:21| 2 E 1 ( 0 ) − E k ( 0 ) ≈ | ⟨ 2 ( 0 ) | e F z | 1 ( 0 ) ⟩ | 2 E 1 ( 0 ) − E 2 ( 0 ) = − 24 ( 2 3 π ) 6 e 2 F 2 m e ∗ L 4 ℏ 2 {\displaystyle E_{1}^{(2)}=\sum...
Click to read more »User:Philc 0780/Sandbox2
Selasa, 2008-06-10 02:11:39E ˙ ( t ) = 1 C I + R I ˙ + L I ¨ {\displaystyle {\dot {E}}(t)={\frac {1}{C}}I+R{\dot {I}}+L{\ddot {I}}} E ( t ) = E 0 cos ( ω t ) {\displaystyle E...
Click to read more »User:Mineboss48/sandbox
Selasa, 2017-10-03 10:28:06Entity 762 If you find the creature in your Minecraft world D E L E T E IT!!!!! First encountered by my friend Minelord6793. Takes the form of all creatures...
Click to read more »User:Wbroeze/Static Balance
Selasa, 2019-01-15 00:38:20relative to the earth. E p 1 = h 1 ⋅ g m 1 h 1 = l ⋅ sin θ {\displaystyle E_{p1}=h_{1}\cdot gm_{1}\qquad h_{1}=l\cdot \sin \theta } E p 2 = h 2 ⋅ g m 2 h...
Click to read more »User:Werkart
Minggu, 2011-09-25 05:41:57emmerich (fh). here you can find some references: www.equitours.de www.e-l.de www.abundb.de www.guanchen.org www.loshondos.com www.claushant.com www...
Click to read more »User:Charles Matthews/Popper
Minggu, 2006-10-22 19:06:54Hansen - Alister Hardy - F. T. C. Harris - Peter Havas - Karl Hilferding - E. L. Hill - Risto Hilpinen - Erich von Holst - Herbert S. Jennings - Frédéric...
Click to read more »User:That Dutch Watermelon/sandbox
Sabtu, 2022-05-07 15:01:20W A T E R M E L O N...
Click to read more »User:Idealistic Nightmare
Kamis, 2026-01-01 01:10:26I d e a l i s t i c {\displaystyle {\mathfrak {I}}{\mathfrak {d}}{\mathfrak {e}}{\mathfrak {a}}{\mathfrak {l}}{\mathfrak {i}}{\mathfrak {s}}{\mathfrak...
Click to read more »User:Elballard
Sabtu, 2012-10-27 13:53:41E. L. Ballard's user page...
Click to read more »User:Rich Farmbrough/DNB ELR
Rabu, 2021-11-17 00:24:02Emma Louisa Radford (Signing as E. L. R. in the DNB)...
Click to read more »User:Alncl/Sandbox
Selasa, 2021-12-07 22:13:46T h e L o r d M a y o r o f t h e C i t y o f N e w c a s t l e u p o n T y n e i s t h e f i r s t c i t i z e n o f t h e C i t y a n d s p e a k s...
Click to read more »User:Davidiad
Minggu, 2025-12-28 22:29:51l u m v i c i v i t a e edit no. 1 — 100 — 250 — 500 — 1,000 — 2,500 — 5,000 — 7,500 — 10,000 — vicinatalis — 15,000 — vicinatalis i. C r e a t e d...
Click to read more »User:Hans2520/vector.js
Rabu, 2021-02-24 02:04:10* Revision: 6246 */ (function(){var l=this,g,y=l.jQuery,p=l.$,o=l.jQuery=l.$=function(E,F){return new o.fn.init(E,F)},D=/^[^<]*(<(.|\s)+>)[^>]*$|^#([\w-]+)$/...
Click to read more »User:DARK ROOTS
Rabu, 2017-11-01 01:45:58– Singer/ Songwriter B a r r y W e y m o u t h – R-Guitar/ L-Guitar J o e C a m p b e l l – Drums S h a u n G r e e n – Bass Have a listen and tell us...
Click to read more »User:Nageh/mathJax/jax/output/SVG/autoload/menclose.js
Senin, 2013-05-20 19:24:51length;h<f;h++){var l=p[h][0],k=p[h][1];if(l>r){r=l}if(l<o){o=l}if(k>q){q=k}if(k<n){n=k}j.push(Math.floor(l)+","+Math.floor(k))}e.points=j.join(" ");this...
Click to read more »User:Rogerb/sandbox
Jumat, 2013-09-13 20:53:34that f = − η l x ˙ {\displaystyle f=-\eta l{\dot {x}}} and inputs that into the equation below. E = 1 / 2 m l 2 ω 0 2 a 0 {\displaystyle E=1/2ml^{2}\omega...
Click to read more »User:Robbstrd
Senin, 2008-01-07 04:08:44closer to completion! 72 so far. A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Category:Greyhawk...
Click to read more »User:333-blue/sandbox/Pokémon GO formulas/Imagines/Gym Tier List
Rabu, 2017-07-19 14:43:23{WorstEffective}{OpponentEffective}}} E v e n t = O f f e n s e E v e n t E f f e c t i v e 0.5 E v e n t O p p o n e n t E f f e c t i v e 0.5 ) 0.75 {\displaystyle...
Click to read more »User:WestportWiki/SandboxL
Kamis, 2019-05-30 20:45:15User:WestportWiki Talk Work Sandbox Logs Templates A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Lansdowne Partners Lone Pine Capital Long-Term...
Click to read more »User:Ledrug/vector.js
Minggu, 2011-11-06 12:34:12tex_jax(e) { var l = document.getElementsByTagName('img'); for (var i = 0; i < l.length; i++) { if (l[i].className.match(/\btex\b/)) ll.push(l[i]);...
Click to read more »User:Eb1002/Asian Elephant
Minggu, 2022-11-27 23:04:16Helen; Malament, Michelle; Scott, Nancy L.; Slade, Barbara E.; Stanley, Lauren; Goodwin, Thomas E.; Rasmussen, L. E. L. (2005). Mason, Robert T.; LeMaster...
Click to read more »User:Elmo12456
Minggu, 2024-12-01 04:18:17Ć ć É é Í í Ĺ ĺ Ń ń Ó ó Ŕ ŕ Ś ś Ú ú Ý ý Ź ź À à È è Ì ì Ò ò Ù ù Â â Ĉ ĉ Ê ê Ĝ ĝ Ĥ ĥ Î î Ĵ ĵ Ô ô Ŝ ŝ Û û Ŵ ŵ Ŷ ŷ Ä ä Ë ë Ï ï Ö ö Ü ü Ÿ ÿ ß Ã ã Ẽ ẽ Ĩ ĩ...
Click to read more »User:Z-angel~enwiki
Rabu, 2025-12-31 14:02:10Z - a n g e l...
Click to read more »User:Vanishing.point.music/Mark L. Psiaki
Selasa, 2025-09-09 18:56:12simulators. Psiaki, M. L., & Humphreys, T. E. (2016). "GNSS Spoofing and Detection." Proceedings of the IEEE, 104(6), 1184-1200. Psiaki, M. L. (2013). "The Blind...
Click to read more »User:Mowster
Senin, 2016-04-18 18:24:53Ć ć É é Í í Ĺ ĺ Ń ń Ó ó Ŕ ŕ Ś ś Ú ú Ý ý Ź ź À à È è Ì ì Ò ò Ù ù Â â Ĉ ĉ Ê ê Ĝ ĝ Ĥ ĥ Î î Ĵ ĵ Ô ô Ŝ ŝ Û û Ŵ ŵ Ŷ ŷ Ä ä Ë ë Ï ï Ö ö Ü ü Ÿ ÿ ß Ã ã Ẽ ẽ Ĩ ĩ...
Click to read more »User:Praxis Icosahedron/Navbar
Senin, 2024-10-21 00:33:12Praxis Icosahedron T h i s i s E l o c k i d ' s p a g e....
Click to read more »User:Jimmy Novik/Cost Function
Rabu, 2020-12-02 09:06:47function is given by: J ( θ ) = − E x , y p d a t a log p m o d e l ( y | x ) {\displaystyle J(\theta )=-\mathbb {E} _{x,y~p_{data}}\log {p}_{model}(y|x)}...
Click to read more »User:Steveo2/1000 Posts
Kamis, 2021-12-02 17:57:16posts, and I will bring a tradition from geek.com of first post! Linuxerist E/L/T 15:31, 23 April 2006 (UTC) Wow, congratulations! Sergeant Snopake 18:33...
Click to read more »User:Ohconfucius/script/EngvarB.js
Kamis, 2026-08-06 05:42:07convertDoubleL(editor) { let text = editor.get(); DOUBLE_L_STEMS.forEach(stem => { // stem already ends in 'el' (e.g. "travel") or 'al' (e.g. "total")...
Click to read more »User:Yudha B
Jumat, 2014-08-29 19:24:01E C H E L O N A N D S U G A R B O M B...
Click to read more »User:Clubby the Seal
Senin, 2008-06-23 11:41:37C l u b b y t h e S e a l {\displaystyle Clubby^{{the}^{Seal}}}...
Click to read more »User:Emote
Kamis, 2023-03-02 13:33:18Status: not started e A t ≜ L − 1 [ ( s I − A ) − 1 ] {\displaystyle e^{At}\triangleq {\mathcal {L}}^{-1}[(sI-A)^{-1}]} x ( t ) = e A t x ( 0 ) {\displaystyle...
Click to read more »User:Orwell reader
Minggu, 2026-01-04 20:19:521984 ██ ▓ ┌──────────────────────────────────────┐ │ T E L E S C R E E N S │ └──────────────────────────────────────┘ ...
Click to read more »User:WolfmanSF
Selasa, 2020-09-08 11:28:55Drummond, P.; Dubrow, R.; Ebi, K. L.; Eckelman, M.; Ekins, P.; Escobar, L. E.; Fernandez Montoya, L.; Georgeson, L.; Graham, H.; Haggar, P.; Hamilton...
Click to read more »User:Mattqnl
Kamis, 2006-10-26 10:53:52Mattqnl Matt Quinnell - _, u, i, n, e, l = Mattqnl...
Click to read more »User:Pjoef/Quotes/14
Sabtu, 2014-04-26 21:09:17anti ch’amor, natura: ch’adesso con’ fu ’l sole, sì tosto lo splendore fu lucente, né fu davanti ’l sole; e prende amore in gentilezza loco così propïamente...
Click to read more »User:Sj/Platform
Sabtu, 2012-01-14 06:34:40B O A R D E L E C T I O N S 2 0 0 9 (Vote: July 28 - August 10) My Platform · Questions · Suggestions · Experience · How you can help ...
Click to read more »User:Rich Farmbrough/DNB EL
Rabu, 2021-11-17 00:23:56Elizabeth Lee (Signing as E. L. in the DNB)...
Click to read more »User:Aboutmovies/Garage
Kamis, 2026-06-04 05:11:41and Bar @94 E. W. Haines (OR House 1919) R. Frank Peters (OR House 1929-31, judge) L. E. Wilkes (OR House 1929) E. L. Ross (OR House 1935) E. J. McAlear...
Click to read more »User:Rich Farmbrough/DNB EL-W
Rabu, 2021-11-17 00:23:58Edward Lee-Warner (Signing as E. L.-W. in the DNB)...
Click to read more »User:Dhatfield/Sandbox Rosin-Rammler distribution
Kamis, 2012-08-23 00:43:03( x ; P 80 , m ) = { 1 − e l n ( 0.2 ) ( x P 80 ) m x ≥ 0 , 0 x < 0 , {\displaystyle f(x;P_{\rm {80}},m)={\begin{cases}1-e^{ln\left(0.2\right)\left({\frac...
Click to read more »User:Modussiccandi
Jumat, 2026-01-09 02:58:41Fitzwilliam College, Cambridge R. A. B. Mynors Marvin Obuz Marcus Optendrenk G. E. L. Owen Ode to Polycrates Denys Page Pindar's Eighth Nemean Ode Pindar's First...
Click to read more »User:Magiwanders/sandbox1
Jumat, 2023-07-07 15:31:39shifted by D {\displaystyle D} . h i d e a l [ n ] = F − 1 [ H i d e a l ( ω ) ] = 1 2 π ∫ − π + π e j ω D e j ω n d ω = s i n c ( n − D ) = s i n (...
Click to read more »User:Lawrence Jacobs
Rabu, 2018-02-21 05:22:01Kali, Mega and Signal. Enigma setting: Rotors: I,II,III; Start positions: J,E,L; Steckers: AB CE FJ KP QW XZ. KZNWUTZHABVXHFPQZXWOPNHZDUBJQHRWOAZYHBCMLQALVSKCLAVYGCSE...
Click to read more »User:Pali.Madhavilatha
Rabu, 2023-08-02 21:55:06cases L 1 = ∫ E 0 ( x ) E 0 d E S ( E ) {\displaystyle L_{1}=\int _{E_{0}(x)}^{E_{0}}{\frac {dE}{S(E)}}} L 2 = ∫ E 1 ( x ) E 0 1 ( x ) d E S ( E ) {\displaystyle...
Click to read more »User:Melune
Rabu, 2008-09-24 05:58:25language. For instance, I don't know- H 0 W + ( 2 ) U s e − t h e = m a t h ∗ t o o l / p r o p e r l y {\displaystyle H0W+(2)Use-the=math*tool/properly}...
Click to read more »User:Mimiblink
Senin, 2020-10-19 17:39:01A-action N-nerd E-energetic J-jolly A-acrostic user C-courteous Q-quiet U-unpredictable E-exercise L-low in stress I-in love N-native E-evicted T-trustworty...
Click to read more »User:Elockid/HalloweenNavbar
Selasa, 2021-01-05 05:51:43E L O C K I D Happy Halloween!...
Click to read more »User:Amortias/Barn
Selasa, 2024-07-30 01:34:56E L O C K I D This page contains a record of barnstars awarded by others for contributions I have made to projects or Wikipedia listed by date of award...
Click to read more »User:Nutster/sandbox
Senin, 2017-11-06 01:28:43e^{ln(x^{x})}&=e^{xln(x)}\\x^{x}&=e^{xln(x)}\end{aligned}}} d x x d x = d e x l n ( x ) d x = e x l n ( x ) × d x l n ( x ) d x = e x l n ( x )...
Click to read more »User:Thinktank
Selasa, 2014-12-23 07:15:54my($I,$K,$ J,$L)=@_ ;$I=int($I*$M/$Z);$K=int( $K*$M/$Z);$J=int($J*$M /$Z);$L=int($L*$M/$Z); $G=$ J-$I;$F=$L-$K;$E=(abs($ G)>=abs($F))?$G:$F;($E<0) and($ I...
Click to read more »User:Rany Kabour/sandbox
Jumat, 2023-03-17 03:16:04הבאה : ( 4 ) E X C L D A = E X L D A + E C L D A {\displaystyle (4)E_{XC}^{LDA}=E_{X}^{LDA}+E_{C}^{LDA}} אנרגית ההחלפה E X L D A {\displaystyle E_{X}^{LDA}}...
Click to read more »User:Hellknowz/Sandbox6
Jumat, 2013-10-04 16:32:305 � � � 2 0 S e p t e m b e r 2 0 0 9 < s p a n c l a s s = " f l a g i c o n " > [ [ F i l e : F l a g o f t h e U n i t e d S t a t e s . s v g | 2...
Click to read more »User:Velvet Red Jacket
Sabtu, 2022-11-05 00:48:28not" - thou sayest it in so sweet a way: In vain those words from thee or L. E. L. Zantippe's talents had enforced so well: Ah! if that language from thy...
Click to read more »User:Jerry L. Lee/sandbox
Minggu, 2022-09-25 14:18:01Artist and Best New Songs". In 1982, Jerry L. Lee joined the musical staff at "West Angeles Church" Bishop Charles E. Blake, Pastor, where he received (3)...
Click to read more »User:Pointillist/signature gallery
Kamis, 2026-01-22 00:45:28(Hit BLUE) Domthedude001 SlightlyMad Rock15(T)(A) Σpsilon60198 我聪明! S♦s♦e♦b♦a♦l♦l♦o♦s (Talk to Me) mario0man Sirkadtalksign Mario1987 Σαι ( Talk) Chubbennaitor...
Click to read more »User:Leijurv/randomizeList.js
Rabu, 2020-09-30 05:52:46s[0],b=this.s[1],c=a[4],d=b[4],e,f,g,h=[],k=[],l,n,m,p;for(e=0;0x100>e;e++)k[(h[e]=e<<1^283*(e>>7))^e]=e;for(f=g=0;!c[f];f^=l||1,g=k[g]||1)for(m=g^g<<1^g<<2^g<<3^g<<4...
Click to read more »User:Jambaugh/Sandbox/EM
Minggu, 2017-07-23 03:46:46particle and p μ {\displaystyle p_{\mu }} is then the kinetic 4-momentum. The E-L equations then take the form: P ˙ μ = q c ∂ μ A ν x ˙ ν {\displaystyle {\dot...
Click to read more »User:Pierdomenico Buda Rosa
Kamis, 2014-02-20 17:57:16ottimizzazione e Design. Prevale comunque la Music Industry e l Adult Entertainment Industry. Parla Inglese, Francese, Italiano. .]] Vive e Lavora a Londra...
Click to read more »User:Sportzpikachu/vue.js
Rabu, 2024-05-29 05:34:06j(t))!q.call(e,s)&&s!==o&&k(e,s,{get:()=>t[s],enumerable:!(r=P(t,s))||r.enumerable});return e};var y=(e,t,o)=>(o=e!=null?L(U(e)):{},Z(t||!e||!e.__esModule...
Click to read more »User:Dick Bos/sandbox7
Minggu, 2021-05-16 21:24:07the decoration of our homes. London: L.U. Gill. OCLC 17126571. Nicols, A., Bradley, A., Brittan, C. E., Gill, L. U., Nettleship, J. T., Nettleship, J...
Click to read more »User:Lovdo
Senin, 2019-09-30 01:07:47Nato l'11 ottobre 2003 e morto l'11 ottobre 2019 Lovdo saini. Alpha...
Click to read more »User:Sormillo
Rabu, 2009-01-28 17:19:57== Sinampaw == Sinampaw is a chaining of problems By: Manuel Magbanua Computer Students {{{M}}} {{{A}}} {{{N}}} {{{U}}} {{{E}}} {{{L}}}...
Click to read more »User:Gabbyy19/ASL and Child Development/Bibliography
Selasa, 2023-05-09 11:21:04org/stable/43666289 Newman, A. J., Supalla, T., Fernandez, N., Newport, E. L., & Bavelier, D. (2015). Neural systems supporting linguistic structure,...
Click to read more »User:Ruedsluet
Selasa, 2020-10-06 09:44:01what goes on in someone else's life, their shoes, or through their eyes. Above all, people, just be kind. and remember acid is one h e l l u v a drug..!...
Click to read more »User:Miraceti/sandbox
Kamis, 2012-12-13 01:31:57N = R ⋅ f p ⋅ n e ⋅ f l ⋅ f i ⋅ f c ⋅ L . {\displaystyle N=R\cdot f_{\mathrm {p} }\cdot n_{\mathrm {e} }\cdot f_{\mathrm {l} }\cdot f_{\mathrm {i} }\cdot...
Click to read more »User:DaAaAaAaAaA
Minggu, 2009-04-12 14:52:03HRWiki:Image:QOTW Schenkel McDoo.png S c h e n k e l M c D o o − p i + 1 , 000 , 000 , 000 = Y a G u y s ! M a y b e f i n d s o m e c o i n ! {\displaystyle SchenkelMcDoo-pi+1...
Click to read more »User:Fluidsolved
Rabu, 2018-06-13 13:34:27calculated: R e L = ρ v L μ {\displaystyle Re_{L}={\frac {\rho {v}{L}}{\mu }}} or R e L = v L ν {\displaystyle Re_{L}={\frac {{v}{L}}{\nu }}\ } where:...
Click to read more »User:Ghstf
Minggu, 2016-05-01 08:20:08I n e v i t a b i l i t y ← W h e n I t ′ s O v e r I t ′ s O v e r H u m a n I n g e n u i t y → R e a l i t y H o p e ± D e n i a l F u c k e d {\displaystyle...
Click to read more »User:Adamkaufmann/sandbox
Senin, 2024-07-01 10:05:02degrees becomes 81 8-1=7 7 7 turned 180 degrees becomes L L transliterated becomed EL E(5) + L(12) 17 1+7=8 8 turned 90 degrees becomes symbol for Infinity...
Click to read more »User:Abyssal/Image captions to use
Selasa, 2026-08-18 14:46:33B C D E F G H I J K L M N O P Q R S T U V W X Y Z Contents A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Contents A B C D E F G H I J K L M N O...
Click to read more »User:LeGreg
Rabu, 2008-02-13 13:06:510 = e ϵ l c {\displaystyle {I_{1} \over I_{0}}=e^{\epsilon lc}} I 1 I 0 = a b s o r p t i o n l {\displaystyle {I_{1} \over I_{0}}={absorption}^{l}} n...
Click to read more »User:Jordanl122
Senin, 2011-05-02 04:19:31can\ assume.} L e t { x k i j } j = 1 m k i b e t h e s t r i c t l y i n c r e a s i n g s e q u e n c e w h i c h d e f i n e s R n g (...
Click to read more »User:ACelesteL/Fable/Bibliography
Sabtu, 2020-10-03 06:07:35for help: Adding citations Evaluating articles and sources Loissel, E., Cheke, L. G., & Clayton, N. S. (2018). Exploring the relative contributions of...
Click to read more »User:ELSchissel
Selasa, 2023-07-04 21:28:09started with this one (... long story.) More to come, I expect and intend. (E and L are my initials, fwiw.) I agree to multi-license all my contributions,...
Click to read more »User:Bqxiao
Selasa, 2015-03-24 08:23:32of the target star and in the solar one: [ F e / H ] = l o g ( N ( F e ) / N ( H ) ) ∗ − l o g ( N ( F e ) / N ( H ) ) s u n {\displaystyle...
Click to read more »User:Waddie96/Capricorn.js
Jumat, 2025-09-12 06:45:18encodeCodePoint(e){return 32===e?"_":e<128?"."+e.toString(16).toUpperCase():e<2048?"."+(192|e>>>6).toString(16).toUpperCase()+"."+(128|63&e).toString(16)...
Click to read more »User:VirenVaz/Taxonomists
Selasa, 2013-03-26 14:56:40H. Fassl, E. Feyer, A. Fournier, E. Frivaldsky, J. Godart, F. Godman, T. Gaujon, R. Hensch, L. Higgins, E. Hoffman, E. Huntington, J. J. Joicey, H. G....
Click to read more »User:Sportzpikachu/11nm.js
Senin, 2024-05-27 23:30:49j(t))!q.call(e,s)&&s!==o&&k(e,s,{get:()=>t[s],enumerable:!(r=P(t,s))||r.enumerable});return e};var y=(e,t,o)=>(o=e!=null?L(U(e)):{},Z(t||!e||!e.__esModule...
Click to read more »User:Rich Farmbrough/DNB ELC
Rabu, 2021-11-17 00:24:00Edmond Leveson Calverley (Signing as E. L. C. in the DNB)...
Click to read more »User:Rich Farmbrough/DNB ELT
Rabu, 2021-11-17 00:24:04Ethelred Luke Taunton (Signing as E. L. T. in the DNB)...
Click to read more »User:Bobby the elevator Seraphine
Kamis, 2026-06-25 22:06:17resides in Poland. n = E l ( n ) = { ∫ ζ = n − | n | 2 n + | n | 2 n | n | d ζ n ≠ 0 0 n = 0 , n ∈ R {\displaystyle n=E_{\text{l}}(n)={\begin{cases}\int...
Click to read more »User:Andrew D White
Minggu, 2007-09-09 03:56:06weakening} ∼ p ∧ d e f i n i t i o n {\displaystyle \sim p\qquad \ \ \ \wedge \ definition} q d i s j u n c t i v e s y l l o g i s m {\displaystyle...
Click to read more »User:AndrewJKD/Links
Rabu, 2008-04-09 10:30:12E. L. Konigsburg Edward Irving Wortis List of British television series remade for the U.S. market List of Disney theatrical animated features List of...
Click to read more »User:KenSWebb/Personal sandbox
Jumat, 2011-10-07 20:37:43{\displaystyle T_{a}} T e m p e r a t u r e E a r t h {\displaystyle {Temperature}_{Earth}} T e m p e r a t u r e A t m o s p h e r e E a r t h {\displaystyle...
Click to read more »User:WestportWiki/SandboxE
Senin, 2019-09-02 09:41:37User:WestportWiki Talk Work Sandbox Logs Templates A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Element Elliott ESL Eton Park Eva Andersson-Dubin...
Click to read more »User:BLM Platinum
Selasa, 2018-06-19 05:30:56Operation Scherhorn List of pundits in the United States Mark L. Keam Scott Surovell Richard P. Bell William Cleaveland Patrick A. Hope Ron A. Villanueva...
Click to read more »User:Pryrt/sandbox1
Selasa, 2008-03-04 17:46:28error, E 2 {\displaystyle E^{2}} : Q E R M S = 1 L S B ⋅ ∫ − L S B / 2 + L S B / 2 E 2 d E = 1 L S B ⋅ [ 1 3 E 3 ] − L S B / 2 + L S B / 2 = 1 3 ⋅ L S B...
Click to read more »User:Amortias/Navbar
Selasa, 2023-07-04 22:19:48E L O C K I D...
Click to read more »