ARTIKELDIGITAL.COM

Krüppel is a gap gene in Drosophila melanogaster, located on the 2R chromosome, which encodes a zinc finger C2H2 transcription factor. Gap genes work...

In molecular genetics, the Krüppel-like family of transcription factors (KLFs) are a set of eukaryotic Cys2His2 zinc finger DNA-binding proteins that...

Krüppel-like factor 4 (KLF4; gut-enriched Krüppel-like factor or GKLF) is a member of the KLF family of zinc finger transcription factors, which belongs...

Krüppel-like factor 15 is a protein that in humans is encoded by the KLF15 gene in the Krüppel-like factor family. Its former designation KKLF stands for...

Krüppel-like Factor 2 (KLF2), also known as lung Krüppel-like Factor (LKLF), is a protein that in humans is encoded by the KLF2 gene on chromosome 19....

The Krüppel associated box (KRAB) domain is a category of transcriptional repression domains present in approximately 400 human zinc finger protein-based...

humans is encoded by the KLF5 gene. This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. Since the protein localizes...

Kruppel like factor 16 is a protein that in humans is encoded by the KLF16 gene. GRCh38: Ensembl release 89: ENSG00000129911 – Ensembl, May 2017 GRCm38:...

Krüppel-like factor 14, also known as basic transcription element-binding protein 5 (BTEB5) is a protein that in humans is encoded by the KLF14 gene....

Krüppel-like factor 3 is a protein that in humans is encoded by the KLF3 gene. KLF3, originally termed Basic Krüppel-like Factor (BKLF), was the third...

the fruit fly Drosophila melanogaster. They found three genes – knirps, Krüppel and hunchback – where mutations caused deletion of particular stretches...

conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates...

former radio station in Seattle, Washington, U.S., whose legacy is KSER Krüppel associated box (KRAB), a transcription repression protein domain Crab (disambiguation)...

and derives from the Proto-Germanic krupilaz. The German and Dutch words Krüppel and kreupel are cognates. By the 1970s, the word generally came to be regarded...

which in humans is encoded by the ZNF559 gene. ZNF559 is a member of the Krüppel C2H2-type zinc finger protein family, characterized by its 13 C2H2-type...

annually in Pakistan Kerala Literature Festival, held annually in India Krüppel-like factors, proteins regulating gene expression Radio KLF, Finland Khalistan...

Kruppel-like factor 13, also known as KLF13, is a protein that in humans is encoded by the KLF13 gene. There is some evidence for KLF13 having a role...

Kruppel-like factor 7 (ubiquitous), also known as KLF7, is a protein which in humans is encoded by the KLF7 gene. This protein is a member of the Kruppel-like...

requirement for a gene regulatory protein followed soon thereafter by the Krüppel factor in Drosophila. It often appears as a metal-binding domain in multi-domain...

and holometabolan development. Most notably, the transcription factor Krüppel homolog 1 (Kr-h1) which is another important antimetamorphic transducer...

Shadow enhancers are important in the regulation of the Krüppel (Kr) gene in Drosophila. The Krüppel gene is involved in early segmentation and creates precise...

(August 1999). "Cloning and characterization of ZNF236, a glucose-regulated Kruppel-like zinc-finger gene mapping to human chromosome 18q22-q23". Genomics...

Johannes “Cobus” Uys, younger brother Spouse Alida Maria Uys Children “Kruppel” Koos (1819–1886) Dirk Cornelis (1823–1838) Petrus Lafras “Piet Hlobane”...

of other gap genes, Krüppel and Knirps, wherein maternal Hunchback expression defines the anterior Knirps and posterior Krüppel borders, while zygotic...

this gene is a Krüppel-related zinc finger protein which is characterized by the presence of an N-terminal repressor domain, the Kruppel-associated box...

domain-containing 7A 479 501 - cgcaaCCCCgcccaccagaggag Kruppel-like factor 7 483 499 + tctggtgGGCGgggttg Erythroid kruppel-like factor 533 549 + ggcaccggtcGGGTggc Hypermethylated...

ISBN 978-1-356-04879-3. Orth, R: „Von einem verantwortungslosen Kameraden zum geistigen Krüppel geschlagen.“ Der Fall des Hitler-Putschisten Heinrich Trambauer. in: Historische...

encodes a zinc finger protein with an N-terminal Kruppel-associated box-containing (KRAB) domain and 11 Kruppel-type C2H2 zinc finger domains. Like other zinc...

Middleweight (– 72.6 kilograms) Frank Crawley England Hans Holdt Denmark Franz Krüppel Germany Light Heavyweight (– 79.4 kilograms) Thyge Petersen Denmark Nils...

this gene. KLF6 has been shown to interact with Sp1 transcription factor. Kruppel-like factors GRCh38: Ensembl release 89: ENSG00000067082 – Ensembl, May...

cellular growth and a proto oncogene. Zbtb7 is a member of the POK (POZ and Krüppel) family of genes, and the ZBTB protein family that contains zinc finger...

Kim MK, Kim MH, Kim J, Hur SS, Kim KS, Hur MW (February 2014). "Human Kruppel-related 3 (HKR3) is a novel transcription activator of alternate reading...

encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription...

Glis1 (Glis Family Zinc Finger 1) is gene encoding a Krüppel-like protein of the same name whose locus is found on Chromosome 1p32.3. The gene is enriched...

(core-binding factor, runt domain, alpha subunit 1) 73 87 + cagtGTGGgtggcga GLI-Kruppel family member GLI3 74 88 - atcgCCACccacact Zinc finger with KRAB and SCAN...

encoded by the ZNF142 gene. The protein encoded by this gene belongs to the Kruppel family of C2H2-type zinc finger proteins. It contains 31 C2H2-type zinc...

proliferation). The mRNA expression of RLIG1 protein is increased with Krüppel-like factor 9 (KLF9) suppression.KLF9 is a transcriptional regulator of...

his research involves the role of transcription factors, particularly Krüppel-like factor 2 (KLF2), in regulating processes such as autophagy, mitophagy...

FT, Law ML, Seuanez HN, O'Brien SJ, Vogelstein B (Feb 1989). "The GLI-Kruppel family of human genes". Mol Cell Biol. 8 (8): 3104–13. doi:10.1128/mcb...

expressed in large sections of the embryo multiple parasegments wide. Kruppel, for instance, is expressed in parasegments 4-6. There are at least 6 types...

TF, alpha CTCTCGCGGGAAGATGCGTCG + Olfactory neuron-specific factor ACCTTTGAGAGCGCCCTTCTACG − Kidney-enriched kruppel-like factor GAAGATGGCGGGGCGAAGT +...

1080/09687599926055. ISSN 0968-7599. LCCN 2007233711. OCLC 808984972. Fandrey, Walter: Krüppel, Idioten, Irre: zur Sozialgeschichte behinderter Menschen in Deutschland...

The following is a partial list of the "D" codes for Medical Subject Headings (MeSH), as defined by the United States National Library of Medicine (NLM)...

this gene mediates transcriptional regulation by interacting with the Krüppel-associated box (KRAB) repression domain found in many transcription factors...

family POU family GATA transcription factor General transcription factor Krüppel-type zinc finger (ZNF) MADS-box gene family NF-kB NOTCH2NL Nuclear receptor...

finger DNA binding motifs and finger linking regions characteristic of the Kruppel family. This gene is part of a gene cluster on chromosome Xp11.23. GRCh38:...

family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located...

the mutant larvae, such as hedgehog, gurken (German: "cucumbers"), and Krüppel ("cripple"). Later, researchers Pavel Tomancak, Amy Beaton, et al., identified...

Danton (1921) Aus dem Schwarzbuch eines Polizeikommissars (1921) – Der Krüppel The Hunt for the Truth (1921) Backstairs (1921) – Der Postbote The Railway...

1. Very rare: 5 families reported to date. KLF11-MODY (MODY 7) 610508 Krüppel-like factor 11 KLF11 has been associated with a form of diabetes that has...

Wang Z, Flintoft RJ, Michel JB, Bassel-Duby R (Dec 1996). "ZBP-89, a Krüppel-like zinc finger protein, inhibits epidermal growth factor induction of...

and III-dependent transcription by the KRAB protein domain of KOX1, a Krüppel-type zinc finger factor". Biol. Chem. 378 (7): 669–77. doi:10.1515/bchm...

integrin ß3, lipoprotein receptor-related protein 6 (LRP6), nucleolin, and Krüppel-like factor 4 (KLF4). Serpin GRCh38: Ensembl release 89: ENSG00000100665...

cell differentiation by MiR-1 may be mediated by the down regulation of Kruppel-like factor 4 (KLF4), since a MiR-1 recognition site is predicted in the...

characterization of mCtBP2, a co-repressor that associates with basic Krüppel-like factor and other mammalian transcriptional regulators". The EMBO Journal...

positioned cysteines and two histidines that are involved in coordinating zinc. Kruppel-related proteins form one family of zinc finger proteins. See MIM 604749...

aberrant mitosis and thus resistance to DNA-damage induced apoptosis. Kruppel-like factor 2 (KLF2) negatively regulates human WEE1, thus increasing sensitivity...

TFIIIA, Sp1 2.3.2 Family: Developmental / cell cycle regulators; includes Krüppel 2.3.4 Family: Large factors with NF-6B-like binding properties 2.4 Class:...

Jane SM, Cunningham JM (January 2002). "Distinct domains of erythroid Krüppel-like factor modulate chromatin remodeling and transactivation at the endogenous...

testis cells. It is a member of the Poxviruses and Zinc-finger (POZ) and Krüppel (POK) family of proteins, and was identified in multiple screens involving...

"Correlative changes in homoeotic and segmentation gene expression in Krüppel mutant embryos of Drosophila". The EMBO Journal. 5 (7): 1659–65. doi:10...

and the isoelectric point is 8.88 pH. The zinc finger protein 229 has a Kruppel-associated box domain (KRAB) at the N-terminus and 17 C2H2 domains (20...

in turn regulate the transcription of gap genes such as giant, knirps, Krüppel, and tailless in a striped pattern, creating the first level of structures...

thereby enhances δEF1-induced transcriptional silencing. CtBP also binds the Kruppel-like factors family of zinc finger proteins KLF3, KLF8 and KLF12. In addition...

cinerochromogenes inhibits adipocyte differentiation of 3T3-L1 cells via Krüppel-like factors 2 and 3". Life Sciences. 135: 35–42. doi:10.1016/j.lfs.2015...

PMC 2888539. PMID 18471545. "Frequent inactivation of the tumor suppressor Kruppel-like factor 6 (KLF6) in hepatocellular carcinoma"[dead link]. Friedman...

19p13.3 GTPBP3: GTP binding protein 3 19p13.11 KLF2: Krüppel-like factor 2, also known as Lung Krüppel-like factor. Gene map locus 19p13.11 OMIM: 602016...

Chen SJ, Yu L, Chen Z (December 1999). "Molecular cloning of six novel Krüppel-like zinc finger genes from hematopoietic cells and identification of a...

linker sequence between zinc fingers. This Gli motif is related to those of Kruppel which is a Drosophila segmentation gene of the gap class. In transgenic...

474–82. doi:10.1016/j.ygeno.2005.12.011. PMID 16460907. "Entrez Gene: KLF17 Kruppel-like factor 17". Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita...

and in the Stutthof concentration camp Krypel (derived from the German "Krüppel," "cripple"). When prisoners reached this emaciated condition, they were...

Varin-Blank N (Jan 2005). "Characterization of VIK-1: a new Vav-interacting Kruppel-like protein". Oncogene. 24 (1): 28–38. doi:10.1038/sj.onc.1208043. PMID 15558030...

found on the plus strand. ZNF730 consists of 14 exons, it encodes for one Kruppel Associated Box (KRAB), and 12 Cys2His2 Zinc Fingers. The mRNA isoform 1...

the regulation of transcription by RNA Polymerase II. It belongs to the Krüppel C2H2-type zinc-finger protein family as it contains many zinc-finger repeats...

(human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09. "KLF7 Kruppel-like factor 7 (ubiquitous) [Homo sapiens (human)] - Gene - NCBI". www.ncbi...

to a related gene on the Y chromosome (ZFY). It encodes a member of the krüppel C2H2-type zinc-finger protein family. The full-length protein contains...

KLF11 is a mesoderm derived, zinc finger transcription factor in the Krüppel-like factor (KLF) family. It binds to SP1- like GC- rich sequences in epsilon...

advisor to the Human Genome Nomenclature Committee on the naming of the Kruppel-like Factor family and as well as identifying and cloning the genes for...

1460-2075.1992.tb05451.x. PMC 556826. PMID 1356762. "Entrez Gene: KLF9 Kruppel-like factor 9". Zucker SN, Fink EE, Bagati A, Mannava S, Bianchi-Smiraglia...

located in this promoter, including binding sites for zinc fingers and Kruppel-like transcription factors. The top 20 transcription binding sites as predicted...

via the sequence motif AGTnnCnnnTGGCT, which it binds to using multiple Kruppel-like factors. It also regulate the expression of Pgm2l1 through the binding...

1128/mcb.10.10.5408. PMC 361243. PMID 2118997. "Entrez Gene: GLI3 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)". Taipale J,...

characterization of mCtBP2, a co-repressor that associates with basic Krüppel-like factor and other mammalian transcriptional regulators". The EMBO Journal...

and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2...

and cytotoxic molecule granulysin (GNLY) and the transcription factor Kruppel-like factor 13 (KLF13). At NIH, Krensky oversaw the Roadmap for Medical...

ZNF521 is a transcription factor with an N-terminal repressor motif and 30 Krüppel-like zinc finger (ZF)3 finger domains. Its N-terminal motif contains 12...

consisting of the effects of many different genes such as even-skipped and Krüppel. What causes spatial and temporal differences in the expression of a single...

proteins Giant and Kruppel. Thus, stripe 2 will only form wherever there is Bicoid and Hunchback, but not where there is Giant and Kruppel. MicroRNA strands...

with Heterochromatic and Euchromatic HP1 Proteins: a Potential Role for Krüppel-Associated Box–Zinc Finger Proteins in Heterochromatin-Mediated Gene Silencing"...

known as GLIS2 is a human gene. The protein encoded by this gene is a Kruppel-like transcription factor which functions depending on the gene and promoter...

S2CID 4427026. Conkright MD, Wani MA, Lingrel JB (August 2001). "Lung Krüppel-like factor contains an autoinhibitory domain that regulates its transcriptional...

inhibits a protein involved in cell proliferation. Ectopic expression of Krüppel-like factor 17 (KLF17) in highly metastatic 4T1 cells suppresses their...

reflects the key features that define this large family of proteins. The Kruppel associated box (KRAB) is a domain of roughly 50 to 75 amino acids positioned...

protein that in humans is encoded by the ZNF320 gene. ZNF320 encodes a Kruppel-like zinc finger protein. Members of this protein family are involved in...

mammal genomes. Zinc-finger genes, particularly those that include a (Krüppel associated box) KRAB domain, exist in high copy number in vertebrate genomes...

induced protein C & related factors 1896 - 0.919 ggcggcggCGGCggagcgc KLFS kruppel like transcription factors 1796 - 0.941 tagggagttGGGGggaggg GCMF Chorion-specific...

Große Brinkgasse 11 in Cologne. In November 1848 he married Magdalena Krüppel (b. 1811), daughter of a physician from Zülpich. They had four children...

PMC 2374985. PMID 17672918. Ai W, Liu Y, Langlois M, Wang TC (March 2004). "Kruppel-like factor 4 (KLF4) represses histidine decarboxylase gene expression...

Epithelial Homeostasis in Mice with Intestine-Specific Deletion of the Krüppel-Like Factor 4 Gene". Developmental Biology. 349 (2): 310–320. doi:10.1016/j...

PMID 12477932. Jiao K, Zhou Y, Hogan BL (2002). "Identification of mZnf8, a mouse Krüppel-like transcriptional repressor, as a novel nuclear interaction partner...

is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and...

Chen SJ, Tong JH, Wang ZY, et al. (March 1993). "Fusion between a novel Krüppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to...

similarity. The domain of function on this gene is known as the KRAB (Kruppel-associated box) domain - A box and it spans from amino acid 7 to 47. It...

Transcription factor Generalized Function KLF17, Krüppel-like factor 17 regulates gene expression, influencing cell differentiation and development. PROX1...

finger, and has been shown to function as a transcriptional repressor. The Kruppel-associated box (KRAB) domain of this protein is found to be responsible...

Bergmann A, Wehri E, et al. (2001). "Imprinting and evolution of two Kruppel-type zinc-finger genes, ZIM3 and ZNF264, located in the PEG3/USP29 imprinted...

spanning 12,380 base pairs. It contains four coding exons. It belongs to the Krüppel associated box (KRAB) C2H2 zinc-finger family and is predicted to act as...

encoded protein contains 20 tandemly arrayed C2H2-type zinc fingers, a Kruppel-associated box (KRAB) domain, and a SCAN box. This transcript turns over...

SYT to two genes, SSX1 and SSX2, encoding proteins with homology to the Kruppel-associated box in human synovial sarcoma". The EMBO Journal. 14 (10): 2333–2340...

finger protein containing five C2H2-type zinc finger domains, one or two Kruppel-associated box A (KRAB A) domains, and a leucine-rich domain. The encoded...

No. 1/2, Alcan, Paris, 1938 Julius Haidvogel (= K. A. Wittfogel), "Der Krüppel "(The Cripple), in Der Gegner, Vol. 2, Nr. 4, Malik, Berlin, 1920, p. 94ff...

KRAB and SCAN domains 5. This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain. ZNF655 Start:...

humans is encoded by the ZNF398 gene. This gene encodes a member of the Kruppel family of C2H2-type zinc-finger transcription factor proteins. The encoded...

positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form one family of zinc finger proteins. See ZFP93 (MIM...

Krueppel-like factor 10 is a protein that in humans is encoded by the KLF10 gene. Kruppel-like factors GRCh38: Ensembl release 89: ENSG00000155090 – Ensembl, May...

(NCBI) Gene database entry for ZNF184 identifies conserved domains KRAB_A (Krüppel associated box) near the N-terminus and Zn-finger (Zinc finger) at the...

apoptosis. This gene encodes a zinc-finger protein, and belongs to the Krüppel C2H2-type zinc-finger protein family. It may be involved in transcriptional...

protein that in humans is encoded by the ZKSCAN1 gene. Chromosome 7 (human) Krüppel associated box (KRAB) domain Zinc finger protein GRCh38: Ensembl release...

That (1928) – Der Manager Alraune (1928) – Der Mörder Luther (1928) – Ein Krüppel Panic (1928) Spione (1928) – Locomotive Engineer (uncredited) Man Against...

characterization of mCtBP2, a co-repressor that associates with basic Krüppel-like factor and other mammalian transcriptional regulators". EMBO J. 17...

finger DNA binding motifs and finger linking regions characteristic of the Kruppel family. This gene is part of a gene cluster on chromosome Xp11.23. Several...

Law ML, Seuanez HN, O'Brien SJ, Vogelstein B (August 1988). "The GLI-Kruppel family of human genes". Molecular and Cellular Biology. 8 (8): 3104–13...

Bech-Hansen NT, Fletcher CD, Coleman MP (May 1994). "Clustered organization of Krüppel zinc-finger genes at Xp11.23, flanking a translocation breakpoint at OATL1:...

9(Transcription factor Jun) ACTGCAGT + ZNF682 CCCCGCACCGG + KLF13 TGGAACGCC + Kruppel like factor 16 GCCCGCCAGG + KLF10 CGGGCGGTCC - YY2 GGCGGCC + LIN54 CTTTGAGC...

encoded by the ZNF684 gene. The zinc finger protein 684 is also known as the Kruppel-associated box protein. Within humans, the ZNF684 gene is found on the...

development Msgn1 (Mesogenin 1) cacaaatcgg + Regulates mesoderm fate KLF2 (Krüppel-like Factor 2) ccccgg − Regulates differentiation ELK1 (ETS-like Kinase...

below. Ccaat-enhancer binding protein KRAB domain zinc finger protein 57 Krüppel-like C2H2 zinc finger factors Octamer binding protein SRY box 9 GLI zinc...

regulatory factor X5 0.758 CEBPB CCAAT/enhancer-binding protein beta 0.959 KLF2 Kruppel-like factor 2 (LKLF) 0.986 CSRNP1 cysteine/serine-rich nuclear protein...

transcriptionally controlled by various transcription factors such as krüppel-like factor 4 (KLF4), GATA3, grainyhead-like 3 (GRHL3), aryl hydrocarbon...

through CD69 interaction and downregulation of the transcription factor Kruppel‑like factor 2. Effector T cells eventually re-express S1PR1 to exit the...

LMTK3 has nuclear roles where is facilitates the interaction between KAP1 (Krüppel-associated box domain-associated protein 1) and a KAP1 phosphatase, PP1α...

family of developmental control genes. giant, huckebein, hunchback, knirps, Krüppel and tailless are all gap genes. Their expression patterns in the early...

Some transcription factors that have the higher matrix similarity are Kruppel-like zinc finger protein 219, zinc finger protein 263, ZKSCAN12 (zinc finger...

Anette; Jäckle, Herbert (September 1985). "Spatial and temporal patterns of Krüppel gene expression in early Drosophila embryos". Nature. 317 (6032): 40–44...

down regulated in choriocarcinoma encode a zinc finger protein related to Krüppel". Molecular and Cellular Biology. 10 (8): 4401–5. doi:10.1128/mcb.10.8...

later university teachers Karl-Heinz Kutschke, Manfred Taschen, Manfred Krüppel [de] and Dieter Schott. Lothar Berg was a board member of the Mathematische...

adenoma gene 1 Cell proliferation 1.000 - gaGGGGgaagggaggcttggccg KLF7 Kruppel-like factor 7 Regulate cell proliferation, differentiation, and survival...

"ICOS maintains the T follicular helper cell phenotype by down-regulating Kruppel-like factor 2". The Journal of Experimental Medicine. 212 (2): 217–233...

oligomerization mediates transcriptional repression by the BRCA1-dependent Kruppel-associated box-zinc finger protein ZBRK1". The Journal of Biological Chemistry...

Arranz V, Le Coniat M, Berger R, Kress M (Dec 1995). "Human and mouse Krüppel-like (MOK2) orthologue genes encode two different zinc finger proteins"...

2001). "Stage-specific modulation of IFN-regulatory factor 4 function by Krüppel-type zinc finger proteins". Journal of Immunology. 166 (10). Baltimore:...

PMID 15838871. S2CID 10264323. Antoine K, Prosperi MT, Ferbus D, et al. (2005). "A Kruppel zinc finger of ZNF 146 interacts with the SUMO-1 conjugating enzyme UBC9...

belonging to TALE class of homeodomain factors 1 tctataaatGTCAatta + ZNF219.01 Kruppel-like zinc finger protein 219 0.913 ctccaCCCCcgtcagcccaaagg + ZBP89.01 Zinc...

Huang B, Ahn YT, McPherson L, et al. (2007). "Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription". J. Immunol. 178 (11): 7081–7...

Heinke J, Diehl P, Pahl HL, Bode C, Patterson C, Moser M (Feb 2010). "Krüppel-like factor 15 regulates BMPER in endothelial cells". Cardiovascular Research...

cAMP-responsive element binding proteins 452 472 - ttgggtTTACgtctccaaggc GLI-Kruppel family member GLI3 74 88 - atcgCCACccacact "Negative" glucocoticoid response...

metabolism, and mitochondrial function. His work has identified the role of Krüppel-like factor 5 (KLF5) in the regulation of cardiac fatty acid metabolism...

guanylate-binding protein 5 [GBP5], dual-specificity phosphatase 3 [DUSP3], and Krüppel-like factor 2 [KLF2] genes to differentiate between active TB and other...

Aveskogh M, Hellman L (1995). "Isolation of cDNA clones for 42 different Krüppel-related zinc finger proteins expressed in the human monoblast cell line...

Shenk T (October 1991). "Transcriptional repression by YY1, a human GLI-Krüppel-related protein, and relief of repression by adenovirus E1A protein". Cell...

cinerochromogenes inhibits adipocyte differentiation of 3T3-L1 cells via Krüppel-like factors 2 and 3". Life Sciences. 135: 35–42. doi:10.1016/j.lfs.2015...

(2014) : Moira - Crazy Count Down (2015) : Checkpoint Charlie - Frühling, der Krüppel [2017) : Munju - Moon You (2019) : Checkpoint Charly - Die Durchsichtige...

splitting samples into groups with similar gene expressions. It was found that Kruppel-like family of transcription factors (KLF2, KLF12, and KLF15), which were...

Blum JL, Simmen FA, Simmen RC (June 2003). "Selective interactions of Kruppel-like factor 9/basic transcription element-binding protein with progesterone...

Chen HL, Chong IW, Lee YC, Tsai JR, Yuan SS, Wang HM, et al. (Aug 2014). "Krüppel-like factor 5 mediates proinflammatory cytokine expression in lipopolysaccharide-induced...

SYT to two genes, SSX1 and SSX2, encoding proteins with homology to the Kruppel-associated box in human synovial sarcoma". EMBO J. 14 (10): 2333–40. doi:10...

PMID 19268449. Fichelson P, Brigui A, Pichaud F (May 2012). "Orthodenticle and Kruppel homolog 1 regulate Drosophila photoreceptor maturation". Proceedings of...

Aveskogh M, Hellman L (1995). "Isolation of cDNA clones for 42 different Krüppel-related zinc finger proteins expressed in the human monoblast cell line...

proteins on human chromosome 6p21.3: members of a new subclass of the Kruppel gene family containing the conserved SCAN box domain". Genomics. 43 (2):...

marker intestinal alkaline phosphatase is a target gene of the gut-enriched Kruppel-like factor". American Journal of Physiology. Gastrointestinal and Liver...

protein that in humans is encoded by the ZNF717 gene. This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group...

(2005). "The leukocyte integrin gene CD11d is repressed by gut-enriched Kruppel-like factor 4 in myeloid cells". J. Biol. Chem. 280 (5): 3449–57. doi:10...

Lecocq PJ, Revelant O, Martial JA (May 1991). "The evolutionarily conserved Krüppel-associated box domain defines a subfamily of eukaryotic multifingered proteins"...

of this gene has been shown to be upregulated by direct binding of the Kruppel like factor 8 protein to promoter sequences. The translated protein interacts...

Aveskogh M, Hellman L (Mar 1995). "Isolation of cDNA clones for 42 different Kruppel-related zinc finger proteins expressed in the human monoblast cell line...

SNAI1/Snail 1, SNAI2/Snail 2 (also known as Slug), ZEB1, ZEB2, TCF3 and KLF8 (Kruppel-like factor 8) can bind to the E-cadherin promoter and repress its transcription...

into adipocytes in vitro. Other pro-adipogenic factors like C/EBPs and Krüppel-like factors (KLFs) have been shown to induce the PPARγ promoter. Moreover...

Crossley M (April 2003). "The LIM protein FHL3 binds basic Krüppel-like factor/Krüppel-like factor 3 and its co-repressor C-terminal-binding protein...

Aveskogh M, Hellman L (Feb 1995). "Isolation of cDNA clones for 42 different Krüppel-related zinc finger proteins expressed in the human monoblast cell line...

theatres took notice of Monot and he played at the Schauspielhaus Zürich (Der Krüppel von Inishmaan), the Theater am Neumarkt Zürich (Raststätte oder Sie machens...

2020. Pollak NM, Hoffman M, Goldberg IJ, Drosatos K (February 2018). "Krüppel-like factors: Crippling and un-crippling metabolic pathways". JACC. Basic...

Biotechnology Information, U.S. National Library of Medicine. "Entrez Gene: KLF8 Kruppel-like factor 8". Alister P. W. Funnell; et al. "Generation of Mice Deficient...

humans is encoded by the ZNF165 gene. This gene encodes a member of the Kruppel family of zinc finger proteins. Members of this DNA-binding protein family...

characterization of mCtBP2, a co-repressor that associates with basic Krüppel-like factor and other mammalian transcriptional regulators". EMBO J. 17...

transcription), a cysteine-serine-rich nuclear protein 1 site (an activator), a Kruppel-like zinc finger protein 219 site (repressor), a stimulating protein 1...

(1999). "Identification of human GC-box-binding zinc finger protein, a new Krüppel-like zinc finger protein, by the yeast one-hybrid screening with a GC-rich...

PMID 26496831. Pollak NM, Hoffman M, Goldberg IJ, Drosatos K (February 2018). "Krüppel-like factors: Crippling and un-crippling metabolic pathways". JACC. Basic...

Michael (1998). "DCtBP mediates transcriptional repression by Knirps, Krüppel and Snail in the Drosophila embryo". The EMBO Journal. 17 (23): 7009–20...

9780521853767, pp. 246–255. M. A. Wani, S. E. Wert, J. B. Lingrel, Lung Kruppel-like factor, a zinc finger transcription factor, is essential for normal...

binding SPIB Spi-B transcription factor MA0081.3 Immune cell regulation KLF5 Krüppel-like factor 5 MA0599.1 Cell growth and differentiation ZBED4 Zinc Finger...

140547. PMID 12055339. Mun GI, Boo YC (April 2012). "A regulatory role of Kruppel-like factor 4 in endothelial argininosuccinate synthetase 1 expression...

2001). "Stage-specific modulation of IFN-regulatory factor 4 function by Krüppel-type zinc finger proteins". Journal of Immunology. 166 (10): 6104–6111...

100 human diseases. RANTES expression is regulated in T lymphocytes by Kruppel like factor 13 (KLF13). The CCL5 gene is activated after 3–5 days after...

Zhou L, Shi X, Ahn YT, Wang D, Clayberger C, Krensky AM (May 2007). "Kruppel-like transcription factor 13 regulates T lymphocyte survival in vivo"....

Huang B, Ahn YT, McPherson L, et al. (2007). "Interaction of PRP4 with Krüppel-Like Factor 13 Regulates CCL5 Transcription". J. Immunol. 178 (11): 7081–7...

molecular weight of 75.7 kDa and an isoelectric point of 9.44. ZNF816 has a Krüppel-associated box, which is characterized by a KRAB domain and an array of...

signaling pathway and subsequent activation of Klf4 (a member of the family of Kruppel-like factors). Oct-4, Sox2 and Nanog positively regulate transcription...

Wang Y, Yang D, Li Y, Wang C, Wu X, Liu M (Jul 2005). "ZNF649, a novel Kruppel type zinc-finger protein, functions as a transcriptional suppressor". Biochem...

repressed by inducing heterochromatinization. For example, the well-studied Krüppel associated box (KRAB) domain can be fused to dCas9 to repress transcription...

represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription...

encoded by the ZNF226 gene. The zinc finger protein 226 is also known as the Kruppel-associated box protein. Within humans, the ZNF226 gene is found on the...

The following is a partial list of the "D" codes for Medical Subject Headings (MeSH), as defined by the United States National Library of Medicine (NLM)...

Platelet-derived growth factor (PDGF), transforming growth factor beta (TGFβ), and Kruppel-like factor 2 (Klf-2) are induced by shear stress and may have up-regulating...

Scheuern pp. 5 Siems, David (2010-10-25). "KrüppelStolz - Selbstbestimmtes Leben: "Alles Kranke ist Last"". KrüppelStolz - Selbstbestimmtes Leben. Retrieved...

expression and cellular localization of ZNF224 and ZNF255, two isoforms of the Krüppel-like zinc-finger protein family". Gene. 403 (1–2): 125–131. doi:10.1016/j...

White, Jonathan A.; Estrada, Javier; DePace, Angela H. (March 2016). "Krüppel Expression Levels Are Maintained through Compensatory Evolution of Shadow...

121871. PMID 26567352. S2CID 37255456. Lueken, Wolfgang; Ricci, Nicola; Krüppel, Thomas (1996). "Rhythmic spontaneous depolarizations determine a slow-and-fast...

"Transcriptional regulation of A33 antigen expression by gut-enriched Krüppel-like factor". Oncogene. 22 (28): 4434–43. doi:10.1038/sj.onc.1206508. PMID 12853980...

9970. PMID 10049742. Numoto M, Yokoro K, Koshi J (1999). "ZF5, which is a Kruppel-type transcriptional repressor, requires the zinc finger domain for self-association"...

myogenesis controller in an on/off switch association mediated by KAP1 (KRAB [Krüppel-like associated box]-associated protein 1) phosphorylation. KAP1 is localized...

May 17, 2014. Numoto M, Yokoro K, Koshi J (March 1999). "ZF5, which is a Kruppel-type transcriptional repressor, requires the zinc finger domain for self-association"...

Schlettow 1920: Das Große Licht - Fritz Rasmussen 1920: Der Todfeind - Krüppel 1920: The Skull of Pharaoh's Daughter - Tirhaka 1920: Schiffe und Menschen...

It also acts synergistically to mediate the interaction between REST (a Kruppel-type zinc finger transcription factor that binds to a 21-bp RE1 silencing...